KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, N-His tag

Cat: MG52935-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All KRT6A/Cytokeratin6A Reagents
CRO Services
Product recommended

All KRT6A/Cytokeratin6A Reagents
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1707 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 315C/T,525C/T,1134A/G not causing the amino acid variation.
Description
Full length Clone DNA of Mouse keratin 6A with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Restriction Sites
KpnI(two restriction sites) + XbaI(6kb+1.08kb+0.64kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
KRT6A/Cytokeratin6A cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, N-His tag Alternative Names
2310016L08Rik cDNA ORF Clone, Mouse;Krt2-6a cDNA ORF Clone, Mouse;Krt2-6c cDNA ORF Clone, Mouse;MK6a cDNA ORF Clone, Mouse;mK6[a] cDNA ORF Clone, Mouse
KRT6A/Cytokeratin6A Background Information
Full Name
keratin 6A, type II

KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
KRT6A/Cytokeratin6A cDNA ORF Clone in Cloning Vector, Mouse MG52935-G
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, untagged MG52935-UT
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52935-ACG
KRT6A/Cytokeratin6A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52935-ACGLN
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52935-ACR
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52935-CF
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52935-NF
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, C-His tag MG52935-CH
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, C-HA tag MG52935-CY
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, N-HA tag MG52935-NY
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, C-Myc tag MG52935-CM
KRT6A/Cytokeratin6A cDNA ORF Clone, Mouse, N-Myc tag MG52935-NM

KRT6A/Cytokeratin6A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
KRT6A/Cytokeratin6A cDNA ORF Clone in Cloning Vector, Human HG13196-G
KRT6A/Cytokeratin6A cDNA ORF Clone in Cloning Vector, Human HG12174-G
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, untagged HG12174-UT
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, untagged HG13196-UT
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-GFPSpark® tag HG12174-ACG
KRT6A/Cytokeratin6A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13196-ACGLN
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-GFPSpark® tag HG13196-ACG
KRT6A/Cytokeratin6A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12174-ACGLN
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-GFPSpark® tag HG12174-ANG
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-GFPSpark® tag HG13196-ANG
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-OFPSpark® tag HG13196-ACR
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-OFPSpark® tag HG12174-ACR
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-OFPSpark® tag HG12174-ANR
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-OFPSpark® tag HG13196-ANR
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13196-CF
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12174-CF
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12174-NF
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13196-NF
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-His tag HG12174-CH
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-His tag HG13196-CH
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-His tag HG12174-NH
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-His tag HG13196-NH
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-HA tag HG13196-CY
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-HA tag HG12174-CY
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-HA tag HG12174-NY
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-HA tag HG13196-NY
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-Myc tag HG12174-CM
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, C-Myc tag HG13196-CM
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-Myc tag HG13196-NM
KRT6A/Cytokeratin6A cDNA ORF Clone, Human, N-Myc tag HG12174-NM
KRT6A/Cytokeratin6A qPCR Primer Pairs, Human HP101775
info info
添加购物车成功! 添加购物车失败!