Klrb1a cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50806-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Klrb1a Reagents
CRO Services
Product recommended

All Klrb1a Reagents
Klrb1a cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
702 bp
Description
Full length Clone DNA of Mouse killer cell lectin-like receptor subfamily B member 1A with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Klrb1a cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
ly-55A cDNA ORF Clone, Mouse;Ly55a cDNA ORF Clone, Mouse;NKR-P1.7 cDNA ORF Clone, Mouse;NKR-P1A cDNA ORF Clone, Mouse;Nkrp1-a cDNA ORF Clone, Mouse;NKRP12 cDNA ORF Clone, Mouse;Nkrp1a cDNA ORF Clone, Mouse
Klrb1a Background Information
Full Name
killer cell lectin-like receptor subfamily B member 1A
References
  • Plougastel B, et al. (2001) Analysis of a 1-Mb BAC contig overlapping the mouse Nkrp1 cluster of genes: cloning of three new Nkrp1 members, Nkrp1d, Nkrp1e, and Nkrp1f. Immunogenetics 53: 592-598.
  • Kogelberg H, et al. (2000) Expression in Escherichia coli, folding in vitro, and characterization of the carbohydrate recognition domain of the natural killer cell receptor NKR-P1A. Protein Expr Purif. 20(1): 10-20.
  • Grazia Cifone M, et al. (1997) NKR-P1A stimulation of arachidonate-generating enzymes in rat NK cells is associated with granule release and cytotoxic activity. J Immunol. 159(1): 309-17.
  • Josien R, et al. (1997) Rat spleen dendritic cells express natural killer cell receptor protein 1 (NKR-P1) and have cytotoxic activity to select targets via a Ca2+-dependent mechanism. J Exp Med. 186: 467-472.
  • Ryan JC, et al. (1995) NKR-P1A is a target-specific receptor that activates natural killer cell cytotoxicity. J Exp Med. 181(5): 1911-5.
  • Lanier L L, et al. (1994) Human NKR-P1A: a disulfide-linked homodimer of the C-type lectin superfamily expressed by a subset of NK and T lymphocytes. J Immunol. 153: 2417-2428.
  • Chambers W, et al. (1989) Monoclonal antibody to a triggering structure expressed on rat natural killer cells and adherent lymphokine-activated killer cells. J Exp Med. 169: 1373-1389.
  • info info
    添加购物车成功! 添加购物车失败!