Kallikrein 7 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50921-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Kallikrein 7 Reagents
CRO Services
Product recommended

All Kallikrein 7 Reagents
Kallikrein 7 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
750 bp
Description
Full length Clone DNA of Mouse kallikrein related-peptidase 7 (chymotryptic, stratum corneum) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Kallikrein 7 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
Prss6 cDNA ORF Clone, Mouse;SCCE cDNA ORF Clone, Mouse
Kallikrein 7 Background Information

Kallikrein-7, also known as kallikrein-related peptidase 7, Stratum corneum chymotryptic enzyme, Serine protease 6, KLK7, and PRSS6, is a secreted protein which belongs to the peptidase S1 family and Kallikrein subfamily. Members of the Kallikrein family are involved in various malignancies such as prostate (PSA, KLK2, KLK15), ovarian (KLK4, KLK5, KLK6, KLK8, KLK10), and breast cancer (KLK10, KLK13, KLK14). Kallikrein-7 / KLK7 appears to be increased in ovarian cancer and higher KLK7 expression in ovarian cancer tissue is associated with poorer prognosis of ovarian cancer patients. Kallikrein-7 / KLK7 is abundantly expressed in the skin and is expressed by keratinocytes in the epidermis. Kallikrein-7 / KLK7 is up-regulated in ovarian carcinoma, especially late-stage serous carcinoma, compared with normal ovaries and benign adenomas (at the protein level). It was significantly associated with shorter overall survival (OS) and disease-free survival (DFS). Kallikrein-7 / KLK7 may catalyze the degradation of intercellular cohesive structures in the cornified layer of the skin in the continuous shedding of cells from the skin surface. KLK7 also plays a role in the activation of precursors to inflammatory cytokines.

Full Name
kallikrein-related peptidase 7
References
  • Hansson L., et al.,(1994), Cloning, expression, and characterization of stratum corneum chymotryptic enzyme. A skin-specific human serine proteinase. J. Biol. Chem. 269:19420-19426.
  • Yousef G.M., et al., (2000), The KLK7 (PRSS6) gene, encoding for the stratum corneum chymotryptic enzyme is a new member of the human kallikrein gene family -- genomic characterization, mapping, tissue expression and hormonal regulation.Gene 254:119-128.
  • Gan L., et al.,(2000), Sequencing and expression analysis of the serine protease gene cluster located in chromosome 19q13 region.Gene 257:119-130.
  • Kallikrein 7 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Kallikrein 7 cDNA ORF Clone in Cloning Vector, Mouse MG50921-G
    Kallikrein 7 cDNA ORF Clone, Mouse, untagged MG50921-UT
    Kallikrein 7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50921-ACGLN
    Kallikrein 7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50921-ACG
    Kallikrein 7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50921-ACR
    Kallikrein 7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50921-CF
    Kallikrein 7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50921-NF
    Kallikrein 7 cDNA ORF Clone, Mouse, C-His tag MG50921-CH
    Kallikrein 7 cDNA ORF Clone, Mouse, N-His tag MG50921-NH
    Kallikrein 7 cDNA ORF Clone, Mouse, C-HA tag MG50921-CY
    Kallikrein 7 cDNA ORF Clone, Mouse, N-HA tag MG50921-NY
    Kallikrein 7 cDNA ORF Clone, Mouse, C-Myc tag MG50921-CM
    Kallikrein 7 qPCR Primer Pairs, Mouse MP200890

    Kallikrein 7 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Kallikrein 7 cDNA ORF Clone in Cloning Vector, Human HG10416-M
    Kallikrein 7 cDNA ORF Clone, Human, untagged HG10416-UT
    Kallikrein 7 cDNA ORF Clone, Human, C-GFPSpark® tag HG10416-ACG
    Kallikrein 7 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10416-ACGLN
    Kallikrein 7 cDNA ORF Clone, Human, C-OFPSpark® tag HG10416-ACR
    Kallikrein 7 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10416-CF
    Kallikrein 7 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10416-NF
    Kallikrein 7 cDNA ORF Clone, Human, C-His tag HG10416-CH
    Kallikrein 7 cDNA ORF Clone, Human, N-His tag HG10416-NH
    Kallikrein 7 cDNA ORF Clone, Human, C-HA tag HG10416-CY
    Kallikrein 7 cDNA ORF Clone, Human, N-HA tag HG10416-NY
    Kallikrein 7 cDNA ORF Clone, Human, C-Myc tag HG10416-CM
    Kallikrein 7 cDNA ORF Clone, Human, N-Myc tag HG10416-NM
    Kallikrein 7 qPCR Primer Pairs, Human HP100446
    info info
    添加购物车成功! 添加购物车失败!