Text Size:AAA

Mouse KLK7/Kallikrein 7(PRSS6) Gene ORF cDNA clone expression plasmid, N-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse KLK7 cDNA Clone Product Information
    NCBI RefSeq:NM_011872.2
    RefSeq ORF Size:750bp
    cDNA Description:Full length Clone DNA of Mus musculus kallikrein related-peptidase 7 (chymotryptic, stratum corneum) with N terminal Flag tag.
    Gene Synonym:SCCE, Prss6, Klk7
    Species:Mouse
    Vector:pCMV3-SP-N-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with KLK7 qPCR primers for gene expression analysis, MP200890 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    Kallikrein-7, also known as kallikrein-related peptidase 7, Stratum corneum chymotryptic enzyme, Serine protease 6, KLK7, and PRSS6, is a secreted protein which belongs to the peptidase S1 family and Kallikrein subfamily. Members of the Kallikrein family are involved in various malignancies such as prostate (PSA, KLK2, KLK15), ovarian (KLK4, KLK5, KLK6, KLK8, KLK10), and breast cancer (KLK10, KLK13, KLK14). Kallikrein-7 / KLK7 appears to be increased in ovarian cancer and higher KLK7 expression in ovarian cancer tissue is associated with poorer prognosis of ovarian cancer patients. Kallikrein-7 / KLK7 is abundantly expressed in the skin and is expressed by keratinocytes in the epidermis. Kallikrein-7 / KLK7 is up-regulated in ovarian carcinoma, especially late-stage serous carcinoma, compared with normal ovaries and benign adenomas (at the protein level). It was significantly associated with shorter overall survival (OS) and disease-free survival (DFS). Kallikrein-7 / KLK7 may catalyze the degradation of intercellular cohesive structures in the cornified layer of the skin in the continuous shedding of cells from the skin surface. KLK7 also plays a role in the activation of precursors to inflammatory cytokines.

    Size / Price
    Catalog: MG50921-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"