Kallikrein 6 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50255-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Kallikrein 6 Reagents
CRO Services
Product recommended

All Kallikrein 6 Reagents
Kallikrein 6 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
741 bp
Description
Full length Clone DNA of Mouse kallikrein related-peptidase 6 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Kallikrein 6 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
AI849898 cDNA ORF Clone, Mouse;BSP cDNA ORF Clone, Mouse;Bssp cDNA ORF Clone, Mouse;Klk29 cDNA ORF Clone, Mouse;MSP cDNA ORF Clone, Mouse;neurosin cDNA ORF Clone, Mouse;Prss18 cDNA ORF Clone, Mouse;Prss9 cDNA ORF Clone, Mouse
Kallikrein 6 Background Information

KLK6 (kallikrein-related peptidase 6), also known as Klk7, belongs to the peptidase S1 family, Kallikrein subfamily. Kallikreins are a subgroup of serine proteases having diverse physiological functions. Growing evidence suggests that many kallikreins are implicated in carcinogenesis and some have potential as novel cancer and other disease biomarkers. KLK6 is a serine protease which exhibits a preference for Arg over Lys in the substrate P1 position and for Ser or Pro in the P2 position. Klk7 shows activity against amyloid precursor protein, myelin basic protein, gelatin, casein and extracellular matrix proteins such as fibronectin, laminin, vitronectin and collagen. KLK6 degrades alpha-synuclein and prevents its polymerization, indicating that KLK6 may be involved in the pathogenesis of Parkinson disease and other synucleinopathies. Klk7 may be involved in regulation of axon outgrowth following spinal cord injury. Tumor cells treated with a neutralizing KLK6 antibody migrate less than control cells, suggesting a role in invasion and metastasis.

Full Name
kallikrein-related peptidase 6
References
  • Krenzer S, et al. (2011) Expression and function of the kallikrein-related peptidase 6 in the human melanoma microenvironment. J Invest Dermatol. 131(11):2281-8.
  • Nathalie HV, et al. (2009) High kallikrein-related peptidase 6 in non-small cell lung cancer cells: an indicator of tumour proliferation and poor prognosis. J Cell Mol Med. 13(9B):4014-22.
  • Kim JT, et al. (2011) Up-regulation and clinical significance of serine protease kallikrein 6 in colon cancer. Cancer. 117(12):2608-19.
  • Scarisbrick IA, et al. (2011) Functional role of kallikrein 6 in regulating immune cell survival. PLoS One. 6(3):e18376.
  • Kallikrein 6 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Kallikrein 6 cDNA ORF Clone in Cloning Vector, Mouse MG50255-M
    Kallikrein 6 cDNA ORF Clone, Mouse, untagged MG50255-UT
    Kallikrein 6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50255-ACG
    Kallikrein 6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50255-ACGLN
    Kallikrein 6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50255-ACR
    Kallikrein 6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50255-CF
    Kallikrein 6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50255-NF
    Kallikrein 6 cDNA ORF Clone, Mouse, C-His tag MG50255-CH
    Kallikrein 6 cDNA ORF Clone, Mouse, N-His tag MG50255-NH
    Kallikrein 6 cDNA ORF Clone, Mouse, C-HA tag MG50255-CY
    Kallikrein 6 cDNA ORF Clone, Mouse, N-HA tag MG50255-NY
    Kallikrein 6 cDNA ORF Clone, Mouse, C-Myc tag MG50255-CM
    Kallikrein 6 qPCR Primer Pairs, Mouse MP200281

    Kallikrein 6 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Kallikrein 6 cDNA ORF Clone in Cloning Vector, Human HG12142-G
    Kallikrein 6 cDNA ORF Clone, Human, untagged HG12142-UT
    Kallikrein 6 cDNA ORF Clone, Human, C-GFPSpark® tag HG12142-ACG
    Kallikrein 6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12142-ACGLN
    Kallikrein 6 cDNA ORF Clone, Human, C-OFPSpark® tag HG12142-ACR
    Kallikrein 6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12142-CF
    Kallikrein 6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12142-NF
    Kallikrein 6 cDNA ORF Clone, Human, C-His tag HG12142-CH
    Kallikrein 6 cDNA ORF Clone, Human, N-His tag HG12142-NH
    Kallikrein 6 cDNA ORF Clone, Human, C-HA tag HG12142-CY
    Kallikrein 6 cDNA ORF Clone, Human, N-HA tag HG12142-NY
    Kallikrein 6 cDNA ORF Clone, Human, C-Myc tag HG12142-CM
    Kallikrein 6 cDNA ORF Clone, Human, N-Myc tag HG12142-NM
    Kallikrein 6 qPCR Primer Pairs, Human HP101800
    info info
    添加购物车成功! 添加购物车失败!