After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse KLK11/Kallikrein 11 Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse KLK11 cDNA Clone Product Information
NCBI RefSeq:NM_001177373.1
RefSeq ORF Size:831bp
cDNA Description:Full length Clone DNA of Mus musculus kallikrein related-peptidase 11 with N terminal Myc tag.
Gene Synonym:TLSP, Prss20, MGC144345, 2310015I08Rik, Klk11
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

kallikrein-related peptidase 11 (KLK11), also known as hippostasin, trypsin-like serine protease and PRSS20, is a member of human tissue kallikrein family. It is a subgroup of serine proteases with diverse physiological functions, which is implicated in carcinogenesis and some with potential that serving as novel biomarkers for ovarian and prostate cancer and other diseases. The KLK11 gene is one of the fifteen kallikrein subfamily members located in a cluster on chromosome 19. Two alternatively spliced forms exist, resulting in 250 (isoform 1) and 282 (isoform 2) amino acid sequences. Isoform 2 is identical to isoform 1, except for an inserted 32 amino acid segment. Isoform 1 is predominantly expressed in brain whereas isoform 2 is preferentially expressed in prostate.

Size / Price
Catalog: MG50919-NM
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"