Kallikrein 1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50915-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Kallikrein 1 Reagents
CRO Services
Product recommended

All Kallikrein 1 Reagents
Kallikrein 1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
786 bp
Description
Full length Clone DNA of Mouse kallikrein 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Kallikrein 1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
0610007D04Rik cDNA ORF Clone, Mouse;Kal cDNA ORF Clone, Mouse;Klk1b6 cDNA ORF Clone, Mouse;Klk6 cDNA ORF Clone, Mouse;mGk-6 cDNA ORF Clone, Mouse
Kallikrein 1 Background Information
Full Name
kallikrein 1

Kallikrein 1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Kallikrein 1 cDNA ORF Clone in Cloning Vector, Mouse MG50915-G
Kallikrein 1 cDNA ORF Clone, Mouse, untagged MG50915-UT
Kallikrein 1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50915-ACG
Kallikrein 1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50915-ACGLN
Kallikrein 1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50915-ACR
Kallikrein 1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50915-CF
Kallikrein 1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50915-NF
Kallikrein 1 cDNA ORF Clone, Mouse, C-His tag MG50915-CH
Kallikrein 1 cDNA ORF Clone, Mouse, N-His tag MG50915-NH
Kallikrein 1 cDNA ORF Clone, Mouse, C-HA tag MG50915-CY
Kallikrein 1 cDNA ORF Clone, Mouse, N-HA tag MG50915-NY
Kallikrein 1 cDNA ORF Clone, Mouse, C-Myc tag MG50915-CM
Kallikrein 1 qPCR Primer Pairs, Mouse MP200884

Kallikrein 1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Kallikrein 1 cDNA ORF Clone in Cloning Vector, Human HG10407-M
Kallikrein 1 cDNA ORF Clone, Human, untagged HG10407-UT
Kallikrein 1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10407-ACG
Kallikrein 1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10407-ACGLN
Kallikrein 1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10407-ACR
Kallikrein 1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10407-CF
Kallikrein 1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10407-NF
Kallikrein 1 cDNA ORF Clone, Human, C-His tag HG10407-CH
Kallikrein 1 cDNA ORF Clone, Human, N-His tag HG10407-NH
Kallikrein 1 cDNA ORF Clone, Human, C-HA tag HG10407-CY
Kallikrein 1 cDNA ORF Clone, Human, N-HA tag HG10407-NY
Kallikrein 1 cDNA ORF Clone, Human, C-Myc tag HG10407-CM
Kallikrein 1 cDNA ORF Clone, Human, N-Myc tag HG10407-NM
Kallikrein 1 qPCR Primer Pairs, Human HP100437
info info
添加购物车成功! 添加购物车失败!