KLF5 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52684-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All KLF5 Reagents
CRO Services
Product recommended

All KLF5 Reagents
KLF5 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1341 bp
Description
Full length Clone DNA of Mouse Kruppel-like factor 5 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KLF5 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
4930520J07Rik cDNA ORF Clone, Mouse;Bteb2 cDNA ORF Clone, Mouse;CKLF cDNA ORF Clone, Mouse;IKLF cDNA ORF Clone, Mouse
KLF5 Background Information
Full Name
Kruppel-like factor 5 (intestinal)

KLF5 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
KLF5 cDNA ORF Clone in Cloning Vector, Mouse MG52684-G
KLF5 cDNA ORF Clone, Mouse, untagged MG52684-UT
KLF5 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52684-ACGLN
KLF5 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52684-ACG
KLF5 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52684-ANG
KLF5 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52684-ACR
KLF5 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52684-ANR
KLF5 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52684-CF
KLF5 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52684-NF
KLF5 cDNA ORF Clone, Mouse, C-His tag MG52684-CH
KLF5 cDNA ORF Clone, Mouse, N-His tag MG52684-NH
KLF5 cDNA ORF Clone, Mouse, C-HA tag MG52684-CY
KLF5 cDNA ORF Clone, Mouse, N-HA tag MG52684-NY
KLF5 cDNA ORF Clone, Mouse, C-Myc tag MG52684-CM
KLF5 qPCR Primer Pairs, Mouse MP202555

KLF5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
KLF5 cDNA ORF Clone in Cloning Vector, Human HG14173-G
KLF5 cDNA ORF Clone, Human, untagged HG14173-UT
KLF5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14173-ACGLN
KLF5 cDNA ORF Clone, Human, C-GFPSpark® tag HG14173-ACG
KLF5 cDNA ORF Clone, Human, N-GFPSpark® tag HG14173-ANG
KLF5 cDNA ORF Clone, Human, C-OFPSpark® tag HG14173-ACR
KLF5 cDNA ORF Clone, Human, N-OFPSpark® tag HG14173-ANR
KLF5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14173-CF
KLF5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14173-NF
KLF5 cDNA ORF Clone, Human, C-His tag HG14173-CH
KLF5 cDNA ORF Clone, Human, N-His tag HG14173-NH
KLF5 cDNA ORF Clone, Human, C-HA tag HG14173-CY
KLF5 cDNA ORF Clone, Human, N-HA tag HG14173-NY
KLF5 cDNA ORF Clone, Human, C-Myc tag HG14173-CM
KLF5 cDNA ORF Clone, Human, N-Myc tag HG14173-NM
KLF5 qPCR Primer Pairs, Human HP102824
info info
添加购物车成功! 添加购物车失败!