c-Kit cDNA ORF Clone, Mouse, C-HA tag

Cat: MG50530-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All c-Kit Reagents
CRO Services
Product recommended

All c-Kit Reagents
c-Kit cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2940 bp
Description
Full length Clone DNA of Mouse kit oncogene with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

c-Kit cDNA ORF Clone, Mouse, C-HA tag Alternative Names
Bs cDNA ORF Clone, Mouse;c-KIT cDNA ORF Clone, Mouse;CD117 cDNA ORF Clone, Mouse;Fdc cDNA ORF Clone, Mouse;Gsfsco1 cDNA ORF Clone, Mouse;Gsfsco5 cDNA ORF Clone, Mouse;Gsfsow3 cDNA ORF Clone, Mouse;SCO1 cDNA ORF Clone, Mouse;SCO5 cDNA ORF Clone, Mouse;SOW3 cDNA ORF Clone, Mouse;Ssm cDNA ORF Clone, Mouse;Tr-kit cDNA ORF Clone, Mouse;W cDNA ORF Clone, Mouse
c-Kit Background Information

C-Kit is a type 3 transmembrane receptor for MGF (mast cell growth factor, also known as stem cell factor). c-Kit contains 5 Ig-like C2-type (immunoglobulin-like) domains.and 1 protein kinase domain. It belongs to the protein kinase superfamily, tyr protein kinase family and CSF-1/PDGF receptor subfamily. C-Kit contains 5 Ig-like C2-type (immunoglobulin-like) domains and 1 protein kinase domain. C-Kit has a tyrosine-protein kinase activity. Binding of the ligands leads to the autophosphorylation of KIT and its association with substrates such as phosphatidylinositol 3-kinase. Antibodies to c-Kit are widely used in immunohistochemistry to help distinguish particular types of tumour in histological tissue sections. It is used primarily in the diagnosis of GISTs. In GISTs, c-Kit staining is typically cytoplasmic, with stronger accentuation along the cell membranes. C-Kit antibodies can also be used in the diagnosis of mast cell tumours and in distinguishing seminomas from embryonal carcinomas. Mutations in c-Kit gene are associated with gastrointestinal stromal tumors, mast cell disease, acute myelogenous lukemia, and piebaldism. Defects in KIT are a cause of acute myelogenous leukemia (AML). AML is a malignant disease in which hematopoietic precursors are arrested in an early stage of development. Note=Somatic mutations that lead to constitutive activation of KIT are detected in AML patients.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog
References
  • Andre C, et al. (1997) Sequence analysis of two genomic regions containing the KIT and the FMS receptor tyrosine kinase genes. Genomics. 39(2):216-26.
  • Yarden Y, et al. (1987) Human proto-oncogene c-kit: a new cell surface receptor tyrosine kinase for an unidentified ligand. EMBO J. 6(11):3341-51.
  • Leong KG, et al. (2008) Generation of a prostate from a single adult stem cell. Nature. 456(7223): 804-8.
  • Edling CE, et al. (2007) c-Kit--a hematopoietic cell essential receptor tyrosine kinase. Int J Biochem Cell Biol. 39(11):1995-8.
  • McIntyre A, et al. (2005) Amplification and overexpression of the KIT gene is associated with progression in the seminoma subtype of testicular germ cell tumors of adolescents and adults. Cancer Res. 65(18):8085-9.
  • c-Kit cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    c-Kit cDNA ORF Clone in Cloning Vector, Rat RG80321-G
    c-Kit cDNA ORF Clone, Rat, untagged RG80321-UT
    c-Kit Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80321-ACGLN
    c-Kit cDNA ORF Clone, Rat, C-GFPSpark® tag RG80321-ACG
    c-Kit cDNA ORF Clone, Rat, C-OFPSpark® tag RG80321-ACR
    c-Kit cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80321-CF
    c-Kit cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80321-NF
    c-Kit cDNA ORF Clone, Rat, C-His tag RG80321-CH
    c-Kit cDNA ORF Clone, Rat, N-His tag RG80321-NH
    c-Kit cDNA ORF Clone, Rat, C-HA tag RG80321-CY
    c-Kit cDNA ORF Clone, Rat, N-HA tag RG80321-NY
    c-Kit cDNA ORF Clone, Rat, C-Myc tag RG80321-CM
    c-Kit cDNA ORF Clone, Rat, N-Myc tag RG80321-NM
    c-Kit qPCR Primer Pairs, Rat RP300292

    c-Kit cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    c-Kit cDNA ORF Clone in Cloning Vector, Mouse MG50530-M
    c-Kit cDNA ORF Clone, Mouse, untagged MG50530-UT
    c-Kit Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50530-ACGLN
    c-Kit cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50530-ACG
    c-Kit cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50530-ACR
    c-Kit cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50530-CF
    c-Kit cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50530-NF
    c-Kit cDNA ORF Clone, Mouse, C-His tag MG50530-CH
    c-Kit cDNA ORF Clone, Mouse, N-His tag MG50530-NH
    c-Kit cDNA ORF Clone, Mouse, N-HA tag MG50530-NY
    c-Kit cDNA ORF Clone, Mouse, C-Myc tag MG50530-CM
    c-Kit cDNA ORF Clone, Mouse, N-Myc tag MG50530-NM
    c-Kit qPCR Primer Pairs, Mouse MP200522

    c-Kit cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    c-Kit cDNA ORF Clone in Cloning Vector, Human HG11996-G
    c-Kit qPCR Primer Pairs, Human HP100064
    info info
    添加购物车成功! 添加购物车失败!