Kell cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50452-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Kell Reagents
CRO Services
Product recommended

All Kell Reagents
Kell cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2142 bp
Description
Full length Clone DNA of Mouse Kell blood group with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Kell cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
CD238 cDNA ORF Clone, Mouse;Ece3 cDNA ORF Clone, Mouse
Kell Background Information
Full Name
Kell blood group, metallo-endopeptidase

Kell cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Kell cDNA ORF Clone in Cloning Vector, Mouse MG50452-M
Kell cDNA ORF Clone, Mouse, untagged MG50452-UT
Kell Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50452-ACGLN
Kell cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50452-ACG
Kell cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50452-ACR
Kell cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50452-CF
Kell cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50452-NF
Kell cDNA ORF Clone, Mouse, C-His tag MG50452-CH
Kell cDNA ORF Clone, Mouse, N-His tag MG50452-NH
Kell cDNA ORF Clone, Mouse, C-HA tag MG50452-CY
Kell cDNA ORF Clone, Mouse, N-HA tag MG50452-NY
Kell cDNA ORF Clone, Mouse, N-Myc tag MG50452-NM
Kell qPCR Primer Pairs, Mouse MP200459

Kell cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Kell cDNA ORF Clone in Cloning Vector, Human HG14954-G
Kell cDNA ORF Clone, Human, untagged HG14954-UT
Kell Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14954-ACGLN
Kell cDNA ORF Clone, Human, C-GFPSpark® tag HG14954-ACG
Kell cDNA ORF Clone, Human, C-OFPSpark® tag HG14954-ACR
Kell cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14954-CF
Kell cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14954-NF
Kell cDNA ORF Clone, Human, C-His tag HG14954-CH
Kell cDNA ORF Clone, Human, N-His tag HG14954-NH
Kell cDNA ORF Clone, Human, C-HA tag HG14954-CY
Kell cDNA ORF Clone, Human, N-HA tag HG14954-NY
Kell cDNA ORF Clone, Human, C-Myc tag HG14954-CM
Kell cDNA ORF Clone, Human, N-Myc tag HG14954-NM
Kell qPCR Primer Pairs, Human HP103583
info info
添加购物车成功! 添加购物车失败!