KAT5/TIP60 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52120-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All KAT5/TIP60 Reagents
CRO Services
Product recommended

All KAT5/TIP60 Reagents
KAT5/TIP60 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1386 bp
Description
Full length Clone DNA of Mouse K(lysine) acetyltransferase 5 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

KAT5/TIP60 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
AI839539 cDNA ORF Clone, Mouse;CPLA2 cDNA ORF Clone, Mouse;Htatip cDNA ORF Clone, Mouse;Htatip1 cDNA ORF Clone, Mouse;PLIP cDNA ORF Clone, Mouse;Tip55 cDNA ORF Clone, Mouse;Tip60 cDNA ORF Clone, Mouse
KAT5/TIP60 Background Information
Full Name
K(lysine) acetyltransferase 5

KAT5/TIP60 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
KAT5/TIP60 cDNA ORF Clone in Cloning Vector, Mouse MG52120-G
KAT5/TIP60 cDNA ORF Clone, Mouse, untagged MG52120-UT
KAT5/TIP60 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52120-ACGLN
KAT5/TIP60 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52120-ACG
KAT5/TIP60 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52120-ANG
KAT5/TIP60 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52120-ACR
KAT5/TIP60 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52120-ANR
KAT5/TIP60 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52120-CF
KAT5/TIP60 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52120-NF
KAT5/TIP60 cDNA ORF Clone, Mouse, C-His tag MG52120-CH
KAT5/TIP60 cDNA ORF Clone, Mouse, N-His tag MG52120-NH
KAT5/TIP60 cDNA ORF Clone, Mouse, C-HA tag MG52120-CY
KAT5/TIP60 cDNA ORF Clone, Mouse, C-Myc tag MG52120-CM
KAT5/TIP60 cDNA ORF Clone, Mouse, N-Myc tag MG52120-NM
KAT5/TIP60 qPCR Primer Pairs, Mouse MP201993

KAT5/TIP60 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
KAT5/TIP60 cDNA ORF Clone in Cloning Vector, Human HG17131-U
KAT5/TIP60 cDNA ORF Clone, Human, untagged HG17131-UT
KAT5/TIP60 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17131-ACGLN
KAT5/TIP60 cDNA ORF Clone, Human, C-GFPSpark® tag HG17131-ACG
KAT5/TIP60 cDNA ORF Clone, Human, N-GFPSpark® tag HG17131-ANG
KAT5/TIP60 cDNA ORF Clone, Human, C-OFPSpark® tag HG17131-ACR
KAT5/TIP60 cDNA ORF Clone, Human, N-OFPSpark® tag HG17131-ANR
KAT5/TIP60 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17131-CF
KAT5/TIP60 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17131-NF
KAT5/TIP60 cDNA ORF Clone, Human, C-His tag HG17131-CH
KAT5/TIP60 cDNA ORF Clone, Human, N-His tag HG17131-NH
KAT5/TIP60 cDNA ORF Clone, Human, C-HA tag HG17131-CY
KAT5/TIP60 cDNA ORF Clone, Human, N-HA tag HG17131-NY
KAT5/TIP60 cDNA ORF Clone, Human, C-Myc tag HG17131-CM
KAT5/TIP60 cDNA ORF Clone, Human, N-Myc tag HG17131-NM
info info
添加购物车成功! 添加购物车失败!