Integrin alpha 11/ITGA11 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50058-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Integrin alpha 11/ITGA11 Reagents
CRO Services
Product recommended

All Integrin alpha 11/ITGA11 Reagents
Integrin alpha 11/ITGA11 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
3567 bp
Description
Full length Clone DNA of Mouse integrin alpha 11 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Integrin alpha 11/ITGA11 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
4732459H24Rik cDNA ORF Clone, Mouse
Integrin alpha 11/ITGA11 Background Information
Full Name
integrin, alpha 11

Integrin alpha 11/ITGA11 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Integrin alpha 11/ITGA11 cDNA ORF Clone in Cloning Vector, Mouse MG50058-M
Integrin alpha 11/ITGA11 cDNA ORF Clone, Mouse, untagged MG50058-UT
Integrin alpha 11/ITGA11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50058-ACG
Integrin alpha 11/ITGA11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50058-ACGLN
Integrin alpha 11/ITGA11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50058-ACR
Integrin alpha 11/ITGA11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50058-CF
Integrin alpha 11/ITGA11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50058-NF
Integrin alpha 11/ITGA11 cDNA ORF Clone, Mouse, C-His tag MG50058-CH
Integrin alpha 11/ITGA11 cDNA ORF Clone, Mouse, N-His tag MG50058-NH
Integrin alpha 11/ITGA11 cDNA ORF Clone, Mouse, C-HA tag MG50058-CY
Integrin alpha 11/ITGA11 cDNA ORF Clone, Mouse, C-Myc tag MG50058-CM
Integrin alpha 11/ITGA11 cDNA ORF Clone, Mouse, N-Myc tag MG50058-NM
Integrin alpha 11/ITGA11 qPCR Primer Pairs, Mouse MP200058

Integrin alpha 11/ITGA11 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Integrin alpha 11/ITGA11 cDNA ORF Clone in Cloning Vector, Human HG13017-M
Integrin alpha 11/ITGA11 cDNA ORF Clone, Human, untagged HG13017-UT
Integrin alpha 11/ITGA11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13017-ACGLN
Integrin alpha 11/ITGA11 cDNA ORF Clone, Human, C-GFPSpark® tag HG13017-ACG
Integrin alpha 11/ITGA11 cDNA ORF Clone, Human, C-OFPSpark® tag HG13017-ACR
Integrin alpha 11/ITGA11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13017-CF
Integrin alpha 11/ITGA11 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13017-NF
Integrin alpha 11/ITGA11 cDNA ORF Clone, Human, C-His tag HG13017-CH
Integrin alpha 11/ITGA11 cDNA ORF Clone, Human, N-His tag HG13017-NH
Integrin alpha 11/ITGA11 cDNA ORF Clone, Human, C-HA tag HG13017-CY
Integrin alpha 11/ITGA11 cDNA ORF Clone, Human, N-HA tag HG13017-NY
Integrin alpha 11/ITGA11 cDNA ORF Clone, Human, C-Myc tag HG13017-CM
Integrin alpha 11/ITGA11 cDNA ORF Clone, Human, N-Myc tag HG13017-NM
Integrin alpha 11/ITGA11 qPCR Primer Pairs, Human HP101677
info info
添加购物车成功! 添加购物车失败!