Integrin alpha 8/ITGA8 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50211-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Integrin alpha 8/ITGA8 Reagents
CRO Services
Product recommended

All Integrin alpha 8/ITGA8 Reagents
Integrin alpha 8/ITGA8 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
3186 bp
Description
Full length Clone DNA of Mouse integrin alpha 8 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Integrin alpha 8/ITGA8 cDNA ORF Clone, Mouse, N-His tag Alternative Names
AI447669 cDNA ORF Clone, Mouse
Integrin alpha 8/ITGA8 Background Information
Full Name
integrin, alpha 8

Integrin alpha 8/ITGA8 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Integrin alpha 8/ITGA8 cDNA ORF Clone in Cloning Vector, Mouse MG50211-M
Integrin alpha 8/ITGA8 cDNA ORF Clone, Mouse, untagged MG50211-UT
Integrin alpha 8/ITGA8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50211-ACGLN
Integrin alpha 8/ITGA8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50211-ACG
Integrin alpha 8/ITGA8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50211-ACR
Integrin alpha 8/ITGA8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50211-CF
Integrin alpha 8/ITGA8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50211-NF
Integrin alpha 8/ITGA8 cDNA ORF Clone, Mouse, C-His tag MG50211-CH
Integrin alpha 8/ITGA8 cDNA ORF Clone, Mouse, C-HA tag MG50211-CY
Integrin alpha 8/ITGA8 cDNA ORF Clone, Mouse, N-HA tag MG50211-NY
Integrin alpha 8/ITGA8 cDNA ORF Clone, Mouse, C-Myc tag MG50211-CM
Integrin alpha 8/ITGA8 cDNA ORF Clone, Mouse, N-Myc tag MG50211-NM
Integrin alpha 8/ITGA8 qPCR Primer Pairs, Mouse MP200239

Integrin alpha 8/ITGA8 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Integrin alpha 8/ITGA8 cDNA ORF Clone in Cloning Vector, Human HG12128-M
Integrin alpha 8/ITGA8 cDNA ORF Clone, Human, untagged HG12128-UT
Integrin alpha 8/ITGA8 cDNA ORF Clone, Human, C-GFPSpark® tag HG12128-ACG
Integrin alpha 8/ITGA8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12128-ACGLN
Integrin alpha 8/ITGA8 cDNA ORF Clone, Human, C-OFPSpark® tag HG12128-ACR
Integrin alpha 8/ITGA8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12128-CF
Integrin alpha 8/ITGA8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12128-NF
Integrin alpha 8/ITGA8 cDNA ORF Clone, Human, C-His tag HG12128-CH
Integrin alpha 8/ITGA8 cDNA ORF Clone, Human, N-His tag HG12128-NH
Integrin alpha 8/ITGA8 cDNA ORF Clone, Human, C-HA tag HG12128-CY
Integrin alpha 8/ITGA8 cDNA ORF Clone, Human, N-HA tag HG12128-NY
Integrin alpha 8/ITGA8 cDNA ORF Clone, Human, C-Myc tag HG12128-CM
Integrin alpha 8/ITGA8 cDNA ORF Clone, Human, N-Myc tag HG12128-NM
Integrin alpha 8/ITGA8 qPCR Primer Pairs, Human HP101654
info info
添加购物车成功! 添加购物车失败!