After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse IVD cDNA Clone Product Information
NCBI RefSeq:NM_019826.3
RefSeq ORF Size:1275bp
cDNA Description:Full length Clone DNA of Mus musculus isovaleryl coenzyme A dehydrogenase with N terminal His tag.
Gene Synonym:AI463340; 1300016K07Rik; 6720455E18Rik
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, N-His tag on other vectors
Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG52067-ACG$225
Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG52067-ACR$225
Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG52067-ANG$225
Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG52067-ANR$225
Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, C-Flag tagMG52067-CF$75
Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, C-His tagMG52067-CH$195
Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, C-Myc tagMG52067-CM$195
Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, C-HA tagMG52067-CY$195
Mouse IVD Gene cDNA clone plasmidMG52067-G$75
Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, N-Flag tagMG52067-NF$195
Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, N-His tagMG52067-NH$195
Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, N-Myc tagMG52067-NM$195
Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, N-HA tagMG52067-NY$195
Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone in cloning vectorMG52067-U$75
Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmidMG52067-UT$195
 Learn more about expression Vectors
Product nameProduct name
Background

Isovaleryl-CoA dehydrogenase, also known as IVD, plays an essential role in processing proteins obtained from the diet. The body breaks down proteins from food into smaller parts called amino acids. Amino acids can be further processed to provide energy for growth and development. Isovaleryl-CoA dehydrogenase helps process a particular amino acid called leucine. Specifically, isovaleryl-CoA dehydrogenase is responsible for the third step in the breakdown of leucine. This step is a chemical reaction that converts a molecule called isovaleryl-CoA to another molecule, 3-methylcrotonyl-CoA. Additional chemical reactions convert 3-methylcrotonyl-CoA into molecules that are used for energy.

References
  • BACHHAWAT BK, et al. (1956) Enzymatic carboxylation of beta-hydroxyisovaleryl coenzyme A. J Biol Chem. 219(2):539-50.
  • Ikeda Y, et al. (1983) Purification and characterization of isovaleryl coenzyme A dehydrogenase from rat liver mitochondria. J Biol Chem. 258(2):1077-85.
  • Tanaka K, et al. (1966) Enzymatic carboxylation of beta-hydroxyisovaleryl coenzyme A. J Biol Chem. 219(2):539-50.
  • Size / Price
    Catalog: MG52067-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"