Text Size:AAA

Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, C-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse IVD cDNA Clone Product Information
    NCBI RefSeq:NM_019826.3
    RefSeq ORF Size:1275 bp
    cDNA Description:Full length Clone DNA of Mus musculus isovaleryl coenzyme A dehydrogenase
    Gene Synonym:1300016K07Rik,6720455E18Rik,AI463340
    Species:Mouse
    Vector:pCMV3-C-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with IVD qPCR primers for gene expression analysis, MP201940 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, C-Flag tag on other vectors
    Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, C-GFPSpark tagMG52067-ACG$225
    Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, C-OFPSpark tagMG52067-ACR$225
    Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, N-GFPSpark tagMG52067-ANG$225
    Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, N-OFPSpark tagMG52067-ANR$225
    Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, C-Flag tagMG52067-CF$195
    Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, C-His tagMG52067-CH$195
    Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, C-Myc tagMG52067-CM$195
    Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, C-HA tagMG52067-CY$195
    Mouse IVD Gene cDNA clone plasmidMG52067-G$75
    Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, N-Flag tagMG52067-NF$195
    Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, N-His tagMG52067-NH$195
    Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, N-Myc tagMG52067-NM$195
    Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmid, N-HA tagMG52067-NY$195
    Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone in cloning vectorMG52067-U$75
    Mouse Isovaleryl-CoA dehydrogenase / IVD Gene ORF cDNA clone expression plasmidMG52067-UT$195
     Learn more about expression Vectors
    Product nameProduct name
    Background

    Isovaleryl-CoA dehydrogenase, also known as IVD, plays an essential role in processing proteins obtained from the diet. The body breaks down proteins from food into smaller parts called amino acids. Amino acids can be further processed to provide energy for growth and development. Isovaleryl-CoA dehydrogenase helps process a particular amino acid called leucine. Specifically, isovaleryl-CoA dehydrogenase is responsible for the third step in the breakdown of leucine. This step is a chemical reaction that converts a molecule called isovaleryl-CoA to another molecule, 3-methylcrotonyl-CoA. Additional chemical reactions convert 3-methylcrotonyl-CoA into molecules that are used for energy.

    References
  • BACHHAWAT BK, et al. (1956) Enzymatic carboxylation of beta-hydroxyisovaleryl coenzyme A. J Biol Chem. 219(2):539-50.
  • Ikeda Y, et al. (1983) Purification and characterization of isovaleryl coenzyme A dehydrogenase from rat liver mitochondria. J Biol Chem. 258(2):1077-85.
  • Tanaka K, et al. (1966) Enzymatic carboxylation of beta-hydroxyisovaleryl coenzyme A. J Biol Chem. 219(2):539-50.
  • Size / Price
    Catalog: MG52067-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"