ITM2A cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51902-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All ITM2A Reagents
CRO Services
Product recommended

All ITM2A Reagents
ITM2A cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
792 bp
Description
Full length Clone DNA of Mouse integral membrane protein 2A with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ITM2A cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
AW108051 cDNA ORF Clone, Mouse;Bricd2a cDNA ORF Clone, Mouse;E25 cDNA ORF Clone, Mouse;Itm2 cDNA ORF Clone, Mouse
ITM2A Background Information
Full Name
integral membrane protein 2A

ITM2A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ITM2A cDNA ORF Clone in Cloning Vector, Rat RG80531-U
ITM2A cDNA ORF Clone, Rat, untagged RG80531-UT
ITM2A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80531-ACGLN
ITM2A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80531-ACG
ITM2A cDNA ORF Clone, Rat, N-GFPSpark® tag RG80531-ANG
ITM2A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80531-ACR
ITM2A cDNA ORF Clone, Rat, N-OFPSpark® tag RG80531-ANR
ITM2A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80531-CF
ITM2A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80531-NF
ITM2A cDNA ORF Clone, Rat, C-His tag RG80531-CH
ITM2A cDNA ORF Clone, Rat, N-His tag RG80531-NH
ITM2A cDNA ORF Clone, Rat, C-HA tag RG80531-CY
ITM2A cDNA ORF Clone, Rat, N-HA tag RG80531-NY
ITM2A cDNA ORF Clone, Rat, C-Myc tag RG80531-CM
ITM2A cDNA ORF Clone, Rat, N-Myc tag RG80531-NM
ITM2A qPCR Primer Pairs, Rat RP300495

ITM2A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ITM2A cDNA ORF Clone in Cloning Vector, Mouse MG51902-G
ITM2A cDNA ORF Clone, Mouse, untagged MG51902-UT
ITM2A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51902-ACG
ITM2A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51902-ACGLN
ITM2A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51902-ANG
ITM2A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51902-ACR
ITM2A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51902-ANR
ITM2A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51902-CF
ITM2A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51902-NF
ITM2A cDNA ORF Clone, Mouse, C-His tag MG51902-CH
ITM2A cDNA ORF Clone, Mouse, N-His tag MG51902-NH
ITM2A cDNA ORF Clone, Mouse, C-HA tag MG51902-CY
ITM2A cDNA ORF Clone, Mouse, N-HA tag MG51902-NY
ITM2A cDNA ORF Clone, Mouse, N-Myc tag MG51902-NM
ITM2A qPCR Primer Pairs, Mouse MP201775

ITM2A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ITM2A cDNA ORF Clone in Cloning Vector, Human HG18298-U
ITM2A cDNA ORF Clone, Human, untagged HG18298-UT
ITM2A cDNA ORF Clone, Human, C-GFPSpark® tag HG18298-ACG
ITM2A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18298-ACGLN
ITM2A cDNA ORF Clone, Human, C-OFPSpark® tag HG18298-ACR
ITM2A cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18298-CF
ITM2A cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18298-NF
ITM2A cDNA ORF Clone, Human, C-His tag HG18298-CH
ITM2A cDNA ORF Clone, Human, N-His tag HG18298-NH
ITM2A cDNA ORF Clone, Human, C-HA tag HG18298-CY
ITM2A cDNA ORF Clone, Human, N-HA tag HG18298-NY
ITM2A cDNA ORF Clone, Human, C-Myc tag HG18298-CM
ITM2A cDNA ORF Clone, Human, N-Myc tag HG18298-NM
info info
添加购物车成功! 添加购物车失败!