Integrin beta 7/ITGB7 cDNA ORF Clone, Mouse, untagged

Cat: MG50355-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Integrin beta 7/ITGB7 Reagents
CRO Services
Product recommended

All Integrin beta 7/ITGB7 Reagents
Integrin beta 7/ITGB7 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2421 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 33G/A not causing the amino acid variation.
Description
Full length Clone DNA of Mouse integrin beta 7.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
HindIII(two restriction sites) + NotI(6.1kb+0.64kb+1.8kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Integrin beta 7/ITGB7 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Integrin beta 7/ITGB7 cDNA ORF Clone, Mouse, untagged Alternative Names
Ly69 cDNA ORF Clone, Mouse
Integrin beta 7/ITGB7 Background Information
Full Name
integrin, beta 7

Integrin beta 7/ITGB7 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Integrin beta 7/ITGB7 cDNA ORF Clone in Cloning Vector, Rat RG80456-G
Integrin beta 7/ITGB7 cDNA ORF Clone, Rat, untagged RG80456-UT
Integrin beta 7/ITGB7 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80456-ACGLN
Integrin beta 7/ITGB7 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80456-ACG
Integrin beta 7/ITGB7 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80456-ACR
Integrin beta 7/ITGB7 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80456-CF
Integrin beta 7/ITGB7 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80456-NF
Integrin beta 7/ITGB7 cDNA ORF Clone, Rat, C-His tag RG80456-CH
Integrin beta 7/ITGB7 cDNA ORF Clone, Rat, N-His tag RG80456-NH
Integrin beta 7/ITGB7 cDNA ORF Clone, Rat, C-HA tag RG80456-CY
Integrin beta 7/ITGB7 cDNA ORF Clone, Rat, N-HA tag RG80456-NY
Integrin beta 7/ITGB7 cDNA ORF Clone, Rat, C-Myc tag RG80456-CM
Integrin beta 7/ITGB7 cDNA ORF Clone, Rat, N-Myc tag RG80456-NM
Integrin beta 7/ITGB7 qPCR Primer Pairs, Rat RP300421

Integrin beta 7/ITGB7 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Integrin beta 7/ITGB7 cDNA ORF Clone in Cloning Vector, Mouse MG50355-M
Integrin beta 7/ITGB7 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50355-ACG
Integrin beta 7/ITGB7 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50355-ACGLN
Integrin beta 7/ITGB7 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50355-ACR
Integrin beta 7/ITGB7 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50355-CF
Integrin beta 7/ITGB7 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50355-NF
Integrin beta 7/ITGB7 cDNA ORF Clone, Mouse, C-His tag MG50355-CH
Integrin beta 7/ITGB7 cDNA ORF Clone, Mouse, N-His tag MG50355-NH
Integrin beta 7/ITGB7 cDNA ORF Clone, Mouse, C-HA tag MG50355-CY
Integrin beta 7/ITGB7 cDNA ORF Clone, Mouse, N-HA tag MG50355-NY
Integrin beta 7/ITGB7 cDNA ORF Clone, Mouse, C-Myc tag MG50355-CM
Integrin beta 7/ITGB7 cDNA ORF Clone, Mouse, N-Myc tag MG50355-NM
Integrin beta 7/ITGB7 qPCR Primer Pairs, Mouse MP200376

Integrin beta 7/ITGB7 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Integrin beta 7/ITGB7 qPCR Primer Pairs, Human HP104885
info info
添加购物车成功! 添加购物车失败!