Quick Order

Mouse CD61/Integrin beta 3/ITGB3 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse ITGB3 cDNA Clone Product Information
NCBI RefSeq:NM_016780.2
RefSeq ORF Size:2364bp
cDNA Description:Full length Clone DNA of Mus musculus integrin beta 3 with N terminal HA tag.
Gene Synonym:CD61, GP3A, INGRB3, MGC159221, MGC159223, Itgb3
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:pCMV3-HA-mITGB3
Restriction Site:KpnI(two restriction sites) + XbaI (6kb + 1.88kb + 0.57kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 945G/A, 2250C/A, 2322T/C, 2373C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse ITGB3 Gene Plasmid Map
Mouse ITGB3 ORF mammalian expression plasmid, N-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"