Quick Order

Text Size:AAA

Mouse CD18/Integrin beta 2/ITGB2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse ITGB2 cDNA Clone Product Information
NCBI RefSeq:NM_008404.4
RefSeq ORF Size:2313bp
cDNA Description:Full length Clone DNA of Mus musculus integrin beta 2.
Gene Synonym:2E6, LAD, Cd18, Lfa1, MF17, LCAMB, AI528527, Itgb2
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mITGB2
Restriction Site:KpnI + NotI (6.1kb + 2.31kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse ITGB2 Gene Plasmid Map
Mouse ITGB2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
Size / Price
Catalog: MG50359-UT
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Mouse ITGB2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"