ISYNA1 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51580-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ISYNA1 Reagents
CRO Services
Product recommended

All ISYNA1 Reagents
ISYNA1 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1674 bp
Description
Full length Clone DNA of Mouse myo-inositol 1-phosphate synthase A1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ISYNA1 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
1300017C10Rik cDNA ORF Clone, Mouse;AU018670 cDNA ORF Clone, Mouse
ISYNA1 Background Information
Full Name
inositol-3-phosphate synthase 1

ISYNA1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ISYNA1 cDNA ORF Clone in Cloning Vector, Rat RG81429-G

ISYNA1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ISYNA1 cDNA ORF Clone in Cloning Vector, Mouse MG51580-G
ISYNA1 cDNA ORF Clone, Mouse, untagged MG51580-UT
ISYNA1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51580-ACG
ISYNA1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51580-ACGLN
ISYNA1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51580-ANG
ISYNA1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51580-ACR
ISYNA1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51580-ANR
ISYNA1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51580-CF
ISYNA1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51580-NF
ISYNA1 cDNA ORF Clone, Mouse, C-His tag MG51580-CH
ISYNA1 cDNA ORF Clone, Mouse, N-His tag MG51580-NH
ISYNA1 cDNA ORF Clone, Mouse, C-HA tag MG51580-CY
ISYNA1 cDNA ORF Clone, Mouse, N-HA tag MG51580-NY
ISYNA1 cDNA ORF Clone, Mouse, C-Myc tag MG51580-CM
ISYNA1 qPCR Primer Pairs, Mouse MP201463

ISYNA1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ISYNA1 cDNA ORF Clone in Cloning Vector, Human HG16639-U
ISYNA1 cDNA ORF Clone, Human, untagged HG16639-UT
ISYNA1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16639-ACGLN
ISYNA1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16639-ACG
ISYNA1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16639-ANG
ISYNA1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16639-ACR
ISYNA1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16639-ANR
ISYNA1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16639-CF
ISYNA1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16639-NF
ISYNA1 cDNA ORF Clone, Human, C-His tag HG16639-CH
ISYNA1 cDNA ORF Clone, Human, N-His tag HG16639-NH
ISYNA1 cDNA ORF Clone, Human, C-HA tag HG16639-CY
ISYNA1 cDNA ORF Clone, Human, N-HA tag HG16639-NY
ISYNA1 cDNA ORF Clone, Human, C-Myc tag HG16639-CM
ISYNA1 cDNA ORF Clone, Human, N-Myc tag HG16639-NM
info info
添加购物车成功! 添加购物车失败!