INTS12/PHF22 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG53017-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All INTS12/PHF22 Reagents
CRO Services
Product recommended

All INTS12/PHF22 Reagents
INTS12/PHF22 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1386 bp
Description
Full length Clone DNA of Mouse integrator complex subunit 12 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

INTS12/PHF22 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
1110020M19Rik cDNA ORF Clone, Mouse;2810027J24Rik cDNA ORF Clone, Mouse;4930529N21Rik cDNA ORF Clone, Mouse;A230056J18Rik cDNA ORF Clone, Mouse;AI666778 cDNA ORF Clone, Mouse;Phf22 cDNA ORF Clone, Mouse
INTS12/PHF22 Background Information
Full Name
integrator complex subunit 12

INTS12/PHF22 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
INTS12/PHF22 cDNA ORF Clone in Cloning Vector, Mouse MG53017-G
INTS12/PHF22 cDNA ORF Clone, Mouse, untagged MG53017-UT
INTS12/PHF22 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53017-ACGLN
INTS12/PHF22 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53017-ACG
INTS12/PHF22 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53017-ANG
INTS12/PHF22 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53017-ACR
INTS12/PHF22 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53017-ANR
INTS12/PHF22 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53017-CF
INTS12/PHF22 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53017-NF
INTS12/PHF22 cDNA ORF Clone, Mouse, C-His tag MG53017-CH
INTS12/PHF22 cDNA ORF Clone, Mouse, N-His tag MG53017-NH
INTS12/PHF22 cDNA ORF Clone, Mouse, C-HA tag MG53017-CY
INTS12/PHF22 cDNA ORF Clone, Mouse, N-HA tag MG53017-NY
INTS12/PHF22 cDNA ORF Clone, Mouse, N-Myc tag MG53017-NM

INTS12/PHF22 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
INTS12/PHF22 cDNA ORF Clone in Cloning Vector, Human HG14817-G
INTS12/PHF22 cDNA ORF Clone, Human, untagged HG14817-UT
INTS12/PHF22 cDNA ORF Clone, Human, C-GFPSpark® tag HG14817-ACG
INTS12/PHF22 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14817-ACGLN
INTS12/PHF22 cDNA ORF Clone, Human, N-GFPSpark® tag HG14817-ANG
INTS12/PHF22 cDNA ORF Clone, Human, C-OFPSpark® tag HG14817-ACR
INTS12/PHF22 cDNA ORF Clone, Human, N-OFPSpark® tag HG14817-ANR
INTS12/PHF22 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14817-CF
INTS12/PHF22 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14817-NF
INTS12/PHF22 cDNA ORF Clone, Human, C-His tag HG14817-CH
INTS12/PHF22 cDNA ORF Clone, Human, N-His tag HG14817-NH
INTS12/PHF22 cDNA ORF Clone, Human, C-HA tag HG14817-CY
INTS12/PHF22 cDNA ORF Clone, Human, N-HA tag HG14817-NY
INTS12/PHF22 cDNA ORF Clone, Human, C-Myc tag HG14817-CM
INTS12/PHF22 cDNA ORF Clone, Human, N-Myc tag HG14817-NM
INTS12/PHF22 qPCR Primer Pairs, Human HP103449
info info
添加购物车成功! 添加购物车失败!