INSIG2 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG52091-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All INSIG2 Reagents
CRO Services
Product recommended

All INSIG2 Reagents
INSIG2 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
678 bp
Description
Full length Clone DNA of Mouse insulin induced gene 2 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

INSIG2 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
2900053I11Rik cDNA ORF Clone, Mouse;C730043J18Rik cDNA ORF Clone, Mouse;Insig-2 cDNA ORF Clone, Mouse
INSIG2 Background Information
Full Name
insulin induced gene 2

INSIG2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
INSIG2 cDNA ORF Clone in Cloning Vector, Rat RG84989-U
INSIG2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84989-ACGLN

INSIG2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
INSIG2 cDNA ORF Clone in Cloning Vector, Mouse MG52091-G
INSIG2 cDNA ORF Clone, Mouse, untagged MG52091-UT
INSIG2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52091-ACG
INSIG2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52091-ACGLN
INSIG2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52091-ACR
INSIG2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52091-CF
INSIG2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52091-NF
INSIG2 cDNA ORF Clone, Mouse, C-His tag MG52091-CH
INSIG2 cDNA ORF Clone, Mouse, N-His tag MG52091-NH
INSIG2 cDNA ORF Clone, Mouse, C-HA tag MG52091-CY
INSIG2 cDNA ORF Clone, Mouse, N-HA tag MG52091-NY
INSIG2 cDNA ORF Clone, Mouse, C-Myc tag MG52091-CM
INSIG2 qPCR Primer Pairs, Mouse MP201964

INSIG2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
INSIG2 cDNA ORF Clone in Cloning Vector, Human HG16273-G
INSIG2 cDNA ORF Clone, Human, untagged HG16273-UT
INSIG2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16273-ACG
INSIG2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16273-ACGLN
INSIG2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16273-ACR
INSIG2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16273-CF
INSIG2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16273-NF
INSIG2 cDNA ORF Clone, Human, C-His tag HG16273-CH
INSIG2 cDNA ORF Clone, Human, N-His tag HG16273-NH
INSIG2 cDNA ORF Clone, Human, C-HA tag HG16273-CY
INSIG2 cDNA ORF Clone, Human, N-HA tag HG16273-NY
INSIG2 cDNA ORF Clone, Human, C-Myc tag HG16273-CM
INSIG2 cDNA ORF Clone, Human, N-Myc tag HG16273-NM
info info
添加购物车成功! 添加购物车失败!