ING1 cDNA ORF Clone, Mouse, untagged

Cat: MG51512-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ING1 Reagents
CRO Services
Product recommended

All ING1 Reagents
ING1 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
558 bp
Description
Full length Clone DNA of Mouse inhibitor of growth family, member 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ING1 cDNA ORF Clone, Mouse, untagged Alternative Names
2610028J21Rik cDNA ORF Clone, Mouse;AA407184 cDNA ORF Clone, Mouse;AI875420 cDNA ORF Clone, Mouse;mING1h cDNA ORF Clone, Mouse;p33Ing1 cDNA ORF Clone, Mouse;p37Ing1b cDNA ORF Clone, Mouse
ING1 Background Information
Full Name
inhibitor of growth family, member 1

ING1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ING1 cDNA ORF Clone in Cloning Vector, Mouse MG51512-U
ING1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51512-ACGLN
ING1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51512-ACG
ING1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51512-ANG
ING1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51512-ACR
ING1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51512-ANR
ING1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51512-CF
ING1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51512-NF
ING1 cDNA ORF Clone, Mouse, C-His tag MG51512-CH
ING1 cDNA ORF Clone, Mouse, N-His tag MG51512-NH
ING1 cDNA ORF Clone, Mouse, C-HA tag MG51512-CY
ING1 cDNA ORF Clone, Mouse, N-HA tag MG51512-NY
ING1 cDNA ORF Clone, Mouse, C-Myc tag MG51512-CM
ING1 cDNA ORF Clone, Mouse, N-Myc tag MG51512-NM
ING1 qPCR Primer Pairs, Mouse MP201396

ING1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
ING1 cDNA ORF Clone in Cloning Vector, Human HG11422-M
ING1 cDNA ORF Clone, Human, untagged HG11422-UT
ING1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11422-ACG
ING1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11422-ACGLN
ING1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11422-ANG
ING1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11422-ACR
ING1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11422-ANR
ING1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11422-CF
ING1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11422-NF
ING1 cDNA ORF Clone, Human, C-His tag HG11422-CH
ING1 cDNA ORF Clone, Human, N-His tag HG11422-NH
ING1 cDNA ORF Clone, Human, C-HA tag HG11422-CY
ING1 cDNA ORF Clone, Human, N-HA tag HG11422-NY
ING1 cDNA ORF Clone, Human, C-Myc tag HG11422-CM
ING1 cDNA ORF Clone, Human, N-Myc tag HG11422-NM
ING1 qPCR Primer Pairs, Human HP101300
info info
添加购物车成功! 添加购物车失败!