Quick Order

Mouse ILKAP Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse ILKAP cDNA Clone Product Information
    NCBI RefSeq:NM_023343.2
    RefSeq ORF Size:1179bp
    cDNA Description:Full length Clone DNA of Mus musculus integrin-linked kinase-associated serine/threonine phosphatase 2C with N terminal Myc tag.
    Gene Synonym:PP2C-DELTA, 0710007A14Rik, 1600009O09Rik
    Species:Mouse
    Vector:pCMV3-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with ILKAP qPCR primers for gene expression analysis, MP202522 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    Integrin-linked kinase-associated serine/threonine phosphatase 2C, also known as ILKAP, is cytoplasm protein which belongs to the PP2C family. ILKAP contains one PP2C-like domain. ILKAP is widely expressed. Highest levels expressed in striated muscle. Much lower levels evident in various smooth muscle tissues. ILKAP may play a role in regulation of cell cycle progression via dephosphorylation of its substrates whose appropriate phosphorylation states might be crucial for cell proliferation. ILKAP selectively associates with integrin linked kinase (ILK), to modulate cell adhesion and growth factor signaling. ILKAP inhibits the ILK-GSK3B signaling axis and may play an important role in inhibiting oncogenic transformation. Integrin-linked kinase ( ILK ) plays key roles in a variety of cell functions, including cell proliferation, adhesion and migration. Within the cell, ILK localizes to multiple sites, including the cytoplasm, focal adhesion complexes that mediate cell adhesion to extracellular substrates, as well as cell-cell junctions in epidermal keratinocytes. Nuclear ILK can be rapidly exported into the cytoplasm through a CRM1-dependent pathway, and its export is enhanced by the type 2C protein phosphatase ILKAP. Nuclear localization of ILK in epidermal keratinocytes is associated with increased DNA synthesis, which is sensitive to inhibition by ILKAP.

    References
  • Leung-Hagesteijn C. et al., 2001, EMBO J. 20: 2160-70.
  • Kumar,A.S. et al., 2004, Oncogene. 23 (19):3454-61.
  • Lammers,T. et al., 2007, Crit Rev Biochem Mol Biol. 42 (6):437-61.
  • Nakrieko,K.A. et al., 2008, Cell Cycle. 7 (14):2157-66.
  • Size / Price
    Catalog: MG52651-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"