IL3RA cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50810-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL3RA Reagents
CRO Services
Product recommended

All IL3RA Reagents
IL3RA cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1191 bp
Description
Full length Clone DNA of Mouse interleukin 3 receptor, alpha chain with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL3RA cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
CD123 cDNA ORF Clone, Mouse;CDw123 cDNA ORF Clone, Mouse;SUT-1 cDNA ORF Clone, Mouse
IL3RA Background Information

Interleukin-3 receptor subunit alpha, also known as IL-3 receptor subunit alpha, IL-3R-alpha, CD123, and IL3RA, is a single-pass type I membrane protein which belongs to the type I cytokine receptor family and Type 5 subfamily. The specific alpha subunit of the interleukin-3 receptor (IL-3Ralpha, CD123) is strongly expressed in various leukemic blasts and leukemic stem cells and seems to be an excellent target for the therapy of leukemias. The WSXWS motif of IL3RA appears to be necessary for proper protein folding and thereby efficient intracellular transport and cell-surface receptor binding. The box one motif of IL3RA is required for JAK interaction and / or activation. IL3RA represents a unique marker for primitive leukemic stem cells. Targeting of IL3RA may be a promising strategy for the preferential ablation of AML cells. Aberrant IL3RA expression is a good marker for monitoring of minimal residual disease. IL3RA is strongly expressed in various leukemic blasts and leukemic stem cells and seems to be an excellent target for the therapy of leukemias. Recent studies have shown that interleukin-3 receptor alpha (CD123) is highly expressed on leukemia stem cells of patients with acute myeloid leukemia, and is correlated with tumor load and poor prognosis. CD123 was highly expressed in the bone marrow of the patients with myelodysplastic syndrome (MDS), significantly correlated with the proportion of bone marrow blasts, and thus might be the marker of MDS malignant clone. IL3RA is also a useful new marker for distinguishing B-cell disorders with circulating villous lymphocytes as its expression is characteristic of typical hairy cell leukemia (HCL) with high sensitivity and specificity.

Full Name
interleukin 3 receptor, alpha (low affinity)
References
  • Del Giudice I, et al. (2004) The diagnostic value of CD123 in B-cell disorders with hairy or villous lymphocytes. Haematologica. 89(3): 303-8.
  • Du X, et al. (2007) New immunotoxins targeting CD123, a stem cell antigen on acute myeloid leukemia cells. J Immunother. 30(6): 607-13.
  • Yue LZ, et al. (2010) Expression of CD123 and CD114 on the bone marrow cells of patients with myelodysplastic syndrome. Chin Med J (Engl). 123(15): 2034-2037.
  • IL3RA cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IL3RA cDNA ORF Clone in Cloning Vector, Canine DG70077-G
    IL3RA cDNA ORF Clone, Canine, untagged DG70077-UT
    IL3RA cDNA ORF Clone, Canine, C-GFPSpark® tag DG70077-ACG
    IL3RA Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70077-ACGLN
    IL3RA cDNA ORF Clone, Canine, C-OFPSpark® tag DG70077-ACR
    IL3RA cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70077-CF
    IL3RA cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70077-NF
    IL3RA cDNA ORF Clone, Canine, C-His tag DG70077-CH
    IL3RA cDNA ORF Clone, Canine, N-His tag DG70077-NH
    IL3RA cDNA ORF Clone, Canine, C-HA tag DG70077-CY
    IL3RA cDNA ORF Clone, Canine, N-HA tag DG70077-NY
    IL3RA cDNA ORF Clone, Canine, C-Myc tag DG70077-CM
    IL3RA cDNA ORF Clone, Canine, N-Myc tag DG70077-NM

    IL3RA cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL3RA cDNA ORF Clone in Cloning Vector, Mouse MG50810-G
    IL3RA cDNA ORF Clone, Mouse, untagged MG50810-UT
    IL3RA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50810-ACG
    IL3RA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50810-ACGLN
    IL3RA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50810-ACR
    IL3RA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50810-CF
    IL3RA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50810-NF
    IL3RA cDNA ORF Clone, Mouse, C-His tag MG50810-CH
    IL3RA cDNA ORF Clone, Mouse, N-His tag MG50810-NH
    IL3RA cDNA ORF Clone, Mouse, C-HA tag MG50810-CY
    IL3RA cDNA ORF Clone, Mouse, N-HA tag MG50810-NY
    IL3RA cDNA ORF Clone, Mouse, C-Myc tag MG50810-CM
    IL3RA qPCR Primer Pairs, Mouse MP200781

    IL3RA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL3RA cDNA ORF Clone in Cloning Vector, Human HG10518-M
    IL3RA cDNA ORF Clone, Human, untagged HG10518-UT
    IL3RA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10518-ACGLN
    IL3RA cDNA ORF Clone, Human, C-GFPSpark® tag HG10518-ACG
    IL3RA cDNA ORF Clone, Human, C-OFPSpark® tag HG10518-ACR
    IL3RA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10518-CF
    IL3RA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10518-NF
    IL3RA cDNA ORF Clone, Human, C-His tag HG10518-CH
    IL3RA cDNA ORF Clone, Human, N-His tag HG10518-NH
    IL3RA cDNA ORF Clone, Human, C-HA tag HG10518-CY
    IL3RA cDNA ORF Clone, Human, N-HA tag HG10518-NY
    IL3RA cDNA ORF Clone, Human, C-Myc tag HG10518-CM
    IL3RA cDNA ORF Clone, Human, N-Myc tag HG10518-NM
    IL3RA qPCR Primer Pairs, Human HP100062
    info info
    添加购物车成功! 添加购物车失败!