Quick Order

Text Size:AAA

Mouse IL3RA/CD123 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse IL3RA cDNA Clone Product Information
NCBI RefSeq:NM_008369.1
RefSeq ORF Size:1191bp
cDNA Description:Full length Clone DNA of Mus musculus interleukin 3 receptor, alpha chain with N terminal His tag.
Gene Synonym:CD123, SUT-1, CDw123
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Interleukin-3 receptor subunit alpha, also known as IL-3 receptor subunit alpha, IL-3R-alpha, CD123, and IL3RA, is a single-pass type I membrane protein which belongs to the type I cytokine receptor family and Type 5 subfamily. The specific alpha subunit of the interleukin-3 receptor (IL-3Ralpha, CD123) is strongly expressed in various leukemic blasts and leukemic stem cells and seems to be an excellent target for the therapy of leukemias. The WSXWS motif of IL3RA appears to be necessary for proper protein folding and thereby efficient intracellular transport and cell-surface receptor binding. The box one motif of IL3RA is required for JAK interaction and / or activation. IL3RA represents a unique marker for primitive leukemic stem cells. Targeting of IL3RA may be a promising strategy for the preferential ablation of AML cells. Aberrant IL3RA expression is a good marker for monitoring of minimal residual disease. IL3RA is strongly expressed in various leukemic blasts and leukemic stem cells and seems to be an excellent target for the therapy of leukemias. Recent studies have shown that interleukin-3 receptor alpha (CD123) is highly expressed on leukemia stem cells of patients with acute myeloid leukemia, and is correlated with tumor load and poor prognosis. CD123 was highly expressed in the bone marrow of the patients with myelodysplastic syndrome (MDS), significantly correlated with the proportion of bone marrow blasts, and thus might be the marker of MDS malignant clone. IL3RA is also a useful new marker for distinguishing B-cell disorders with circulating villous lymphocytes as its expression is characteristic of typical hairy cell leukemia (HCL) with high sensitivity and specificity.

References
  • Del Giudice I, et al. (2004) The diagnostic value of CD123 in B-cell disorders with hairy or villous lymphocytes. Haematologica. 89(3): 303-8.
  • Du X, et al. (2007) New immunotoxins targeting CD123, a stem cell antigen on acute myeloid leukemia cells. J Immunother. 30(6): 607-13.
  • Yue LZ, et al. (2010) Expression of CD123 and CD114 on the bone marrow cells of patients with myelodysplastic syndrome. Chin Med J (Engl). 123(15): 2034-2037.
  • Size / Price
    Catalog: MG50810-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"