Quick Order

Mouse IL-1F5 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse IL36RN cDNA Clone Product Information
NCBI RefSeq:NM_019451.1
RefSeq ORF Size:468bp
cDNA Description:Full length Clone DNA of Mus musculus interleukin 1 family, member 5 (delta) with N terminal His tag.
Gene Synonym:IL-1H3, IL1HY1, AI413231, FIL1delta
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Interleukin-1 family member 5 (IL-1F5), also known as interleukin 36 receptor antagonist (IL36RA), is a member of the interleukin 1 cytokine family. This cytokine was shown to specifically inhibit the activation of NF-kappaB induced by interleukin 1 family, member 6 (IL1F6). IL-1F5 is a highly and a specific antagonist of the IL-1 receptor-related protein 2-mediated response to interleukin 1 family member 9 (IL1F9). IL-1F5 could constitute part of an independent signaling system analogous to interleukin-1 alpha (IL-1A), beta (IL-1B) receptor agonist and interleukin-1 receptor type I (IL-1R1), which is present in epithelial barriers and takes part in local inflammatory response. It has been proved that IL-1F5 induces IL-4 mRNA and protein expression in glia in vitro and enhances hippocampal expression of IL-4 following intracerebroventricular injection. The inhibitory effect of IL-1F5 on LPS-induced IL-1β is attenuated in cells from IL-4-defective mice. Experiment results suggest that IL-1F5 mediates anti-inflammatory effects through its ability to induce IL-4 production and that this is a consequence of its interaction with the orphan receptor, single Ig IL-1R-related molecule (SIGIRR)/TIR8, as the effects were not observed in SIGIRR−/− mice. In contrast to its effects in brain tissue, IL-1F5 did not attenuate LPS-induced changes, or up-regulated IL-4 in macrophages or dendritic cells, suggesting that the effect is confined to the brain.

References
  • Nicklin MJ, et al. (1994) A physical map of the region encompassing the human interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist genes. Genomics. 19 (2): 382-4.
  • Debets R, et al. (2001) Two novel IL-1 family members, IL-1 delta and IL-1 epsilon, function as an antagonist and agonist of NF-kappa B activation through the orphan IL-1 receptor-related protein 2. J Immunol. 167 (3): 1440-6.
  • Costelloe C, et al. (2008) IL-1F5 mediates anti-inflammatory activity in the brain through induction of IL-4 following interaction with SIGIRR/TIR8. J Neurochem. 105(5): 1960-9.
  •  

    Size / Price
    Catalog: MG50213-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"