IL36 gamma cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51179-CF
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IL36 gamma Reagents
CRO Services
Product recommended

All IL36 gamma Reagents
IL36 gamma cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
495 bp
Description
Full length Clone DNA of Mouse interleukin 1 family, member 9 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL36 gamma cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
Il1f9 cDNA ORF Clone, Mouse;IL36g cDNA ORF Clone, Mouse
IL36 gamma Background Information
Full Name
interleukin 36, gamma
References
  • Dinarello CA. (2002) The IL-1 family and inflammatory diseases. Clin Exp Rheumatol. 20(5): 1-13.
  • Berglof E, et al. (2003) IL-1Rrp2 expression and IL-1F9 (IL-1H1) actions in brain cells. J Neuroimmunol. 139(1-2): 36-43.
  • Dunn E, et al. (2001) Annotating genes with potential roles in the immune system: six new members of the IL-1 family. Trends Immunol.22(10): 533-6.
  • Towne JE, et al. (2004) Interleukin (IL)-1F6, IL-1F8, and IL-1F9 signal through IL-1Rrp2 and IL-1RAcP to activate the pathway leading to NF-kappaB and MAPKs. J Biol Chem. 279(14): 13677-88.
  • IL36 gamma cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL36 gamma cDNA ORF Clone in Cloning Vector, Mouse MG51179-M
    IL36 gamma cDNA ORF Clone, Mouse, untagged MG51179-UT
    IL36 gamma Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51179-ACGLN
    IL36 gamma cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51179-ACG
    IL36 gamma cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51179-ACR
    IL36 gamma cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51179-NF
    IL36 gamma cDNA ORF Clone, Mouse, C-His tag MG51179-CH
    IL36 gamma cDNA ORF Clone, Mouse, N-His tag MG51179-NH
    IL36 gamma cDNA ORF Clone, Mouse, C-HA tag MG51179-CY
    IL36 gamma cDNA ORF Clone, Mouse, N-HA tag MG51179-NY
    IL36 gamma cDNA ORF Clone, Mouse, C-Myc tag MG51179-CM
    IL36 gamma cDNA ORF Clone, Mouse, N-Myc tag MG51179-NM
    IL36 gamma qPCR Primer Pairs, Mouse MP200317

    IL36 gamma cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL36 gamma cDNA ORF Clone in Cloning Vector, Human HG10124-M
    IL36 gamma cDNA ORF Clone, Human, untagged HG10124-UT
    IL36 gamma cDNA ORF Clone, Human, C-GFPSpark® tag HG10124-ACG
    IL36 gamma Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10124-ACGLN
    IL36 gamma cDNA ORF Clone, Human, C-OFPSpark® tag HG10124-ACR
    IL36 gamma cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10124-CF
    IL36 gamma cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10124-NF
    IL36 gamma cDNA ORF Clone, Human, C-His tag HG10124-CH
    IL36 gamma cDNA ORF Clone, Human, N-His tag HG10124-NH
    IL36 gamma cDNA ORF Clone, Human, C-HA tag HG10124-CY
    IL36 gamma cDNA ORF Clone, Human, N-HA tag HG10124-NY
    IL36 gamma cDNA ORF Clone, Human, C-Myc tag HG10124-CM
    IL36 gamma cDNA ORF Clone, Human, N-Myc tag HG10124-NM
    IL36 gamma qPCR Primer Pairs, Human HP100197
    info info
    添加购物车成功! 添加购物车失败!