Quick Order

Mouse IL36G Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse IL36G cDNA Clone Product Information
NCBI RefSeq:NM_153511.2
RefSeq ORF Size:495bp
cDNA Description:Full length Clone DNA of Mus musculus interleukin 1 family, member 9 with C terminal His tag.
Gene Synonym:IL1F9
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
References
  • Dinarello CA. (2002) The IL-1 family and inflammatory diseases. Clin Exp Rheumatol. 20(5): 1-13.
  • Berglof E, et al. (2003) IL-1Rrp2 expression and IL-1F9 (IL-1H1) actions in brain cells. J Neuroimmunol. 139(1-2): 36-43.
  • Dunn E, et al. (2001) Annotating genes with potential roles in the immune system: six new members of the IL-1 family. Trends Immunol.22(10): 533-6.
  • Towne JE, et al. (2004) Interleukin (IL)-1F6, IL-1F8, and IL-1F9 signal through IL-1Rrp2 and IL-1RAcP to activate the pathway leading to NF-kappaB and MAPKs. J Biol Chem. 279(14): 13677-88.
  • Size / Price
    Catalog: MG51179-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"