Quick Order

Text Size:AAA

Mouse IL-34 transcript variant 1 Gene ORF cDNA clone expression plasmid, N-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse IL34 cDNA Clone Product Information
NCBI RefSeq:NM_001135100.1
RefSeq ORF Size:708bp
cDNA Description:Full length Clone DNA of Mus musculus interleukin 34, transcript variant 1 with C terminal HA tag.
Gene Synonym:AI593503, 2010004A03Rik, Il34
Species:Mouse
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Interleukin 34 (IL-34), also known as uncharacterized protein C16 or f77 homolog, is a secreted cytokine that belongs to unknown cytokine family. IL-34 protein is expressed in various tissues, including heart, brain, lung, liver, kidney, spleen, thymus, testes, ovary, small intestine, prostate and colon, and most abundant in the spleen. The colony-stimulating factor 1 receptor (CSF-1R) is identified as the receptor for IL-34. IL-34 increases growth or survival of immune cells known as monocytes. In addition, IL-34 promoted the formation of the colony-forming unit-macrophage (CFU-M), a macrophage progenitor, in human bone marrow cultures.

References
  • Lin H, et al. (2008) Discovery of a cytokine and its receptor by functional screening of the extracellular proteome. Science. 320(5877): 807-11.
  • Size / Price
    Catalog: MG50055-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"