Quick Order

Mouse IL-33 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse IL33 cDNA Clone Product Information
NCBI RefSeq:NM_133775.1
RefSeq ORF Size:801bp
cDNA Description:Full length Clone DNA of Mus musculus interleukin 33 with N terminal His tag.
Gene Synonym:Il-33, Il1f11, NF-HEV, 9230117N10Rik
Species:Mouse
Vector:pCMV3-N-His
Plasmid:pCMV3-His-mIL33
Restriction Site:HindIII + XbaI (6kb + 0.85kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IL33 qPCR primers for gene expression analysis, MP200148 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse IL33 Gene Plasmid Map
Mouse IL33 / NF-HEV natural ORF mammalian expression plasmid, N-His tag
Immunochemical staining of human CCNF in human brain with rabbit polyclonal antibody (1 µg/mL, formalin-fixed paraffin embedded sections).
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Interleukin 33 (IL-33), also known as DVS27 or NF-HEV (Nuclear Factor from High Endothelial enules), is a proinflammatory protein and a chromatin-associated cytokine of the IL-1 family with high sequence and structural similarity to IL-1 and IL-18. IL-33 protein is expressed highly and rather selectively by high endothelial venule endothelial cells (HEVECs) in human tonsils, Peyers's patches, and lymph nodes. IL-33 protein has transcriptional regulatory properties, and the researches suggested that IL-33 is a dual-function protein that might act both as a cytokine and as an intracellular nuclear factor. As a type 2 cytokines, IL-33 protein also play a pivotal role in helminthic infection and allergic disorders.

References
  • Iikura M, et al. (2007) IL-33 can promote survival, adhesion and cytokine production in human mast cells. Lab Invest. 87(10): 971-8.
  • Lamkanfi M, et al. (2009) IL-33 raises alarm. Immunity. 31(1): 5-7.
  • Size / Price
    Catalog: MG50118-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry
    Contact Us
    Images
    • Mouse IL33 / NF-HEV natural ORF mammalian expression plasmid, N-His tag
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"