IL31 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51070-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL31 Reagents
CRO Services
Product recommended

All IL31 Reagents
IL31 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
492 bp
Description
Full length Clone DNA of Mouse interleukin 31 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL31 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
1700013B14Rik cDNA ORF Clone, Mouse
IL31 Background Information
Full Name
interleukin 31

IL31 cDNA ORF Clone, Cynomolgus, Related Products

Product Name Catalog#(PDF)
IL31 cDNA ORF Clone, Cynomolgus, C-DDK (Flag®) tag CG90895-CF

IL31 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IL31 cDNA ORF Clone in Cloning Vector, Mouse MG51070-G
IL31 cDNA ORF Clone, Mouse, untagged MG51070-UT
IL31 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51070-ACGLN
IL31 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51070-ACG
IL31 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51070-ACR
IL31 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51070-NF
IL31 cDNA ORF Clone, Mouse, C-His tag MG51070-CH
IL31 cDNA ORF Clone, Mouse, N-His tag MG51070-NH
IL31 cDNA ORF Clone, Mouse, C-HA tag MG51070-CY
IL31 cDNA ORF Clone, Mouse, N-HA tag MG51070-NY
IL31 cDNA ORF Clone, Mouse, C-Myc tag MG51070-CM
IL31 cDNA ORF Clone, Mouse, N-Myc tag MG51070-NM
IL31 qPCR Primer Pairs, Mouse MP201025

IL31 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IL31 cDNA ORF Clone in Cloning Vector, Human HG11557-M
IL31 cDNA ORF Clone, Human, untagged HG11557-UT
IL31 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11557-ACGLN
IL31 cDNA ORF Clone, Human, C-GFPSpark® tag HG11557-ACG
IL31 cDNA ORF Clone, Human, C-OFPSpark® tag HG11557-ACR
IL31 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11557-CF
IL31 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11557-NF
IL31 cDNA ORF Clone, Human, C-His tag HG11557-CH
IL31 cDNA ORF Clone, Human, N-His tag HG11557-NH
IL31 cDNA ORF Clone, Human, C-HA tag HG11557-CY
IL31 cDNA ORF Clone, Human, N-HA tag HG11557-NY
IL31 cDNA ORF Clone, Human, C-Myc tag HG11557-CM
IL31 cDNA ORF Clone, Human, N-Myc tag HG11557-NM
IL31 qPCR Primer Pairs, Human HP101423
info info
添加购物车成功! 添加购物车失败!