After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse IL-27 Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse IL27 cDNA Clone Product Information
NCBI RefSeq:NM_145636.1
RefSeq ORF Size:705bp
cDNA Description:Full length Clone DNA of Mus musculus interleukin 27 with C terminal His tag.
Gene Synonym:p28, Il30, IL-27, IL-27p28
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

IL-27 protein is a member of the IL-6 superfamily, which is expressed on monocytes, endothelial cells and dendritic cells. IL-27 protein is also referred as the IL-12 p35-related protein, p28, is one subunit of a heterodimeric cytokine complex, and associates with another subunit EBI3 (EBV-induced gene 3), an IL-12 p40-related protein (IL-27B). IL-27 protein is an early product of activated antigen-presenting cells and drives rapid clonal expansion of naive CD4(+) T cells and plays a role in the early regulation of Th1 cells initiation which drives efficient adaptive immune response. IL-27 protein has an antiproliferative activity on melanomas through WSX-1/STAT1 signaling. Thus, IL-27 protein may be an attractive candidate as an antitumor agent applicable to cancer immunotherapy.

References
  • Hisada M, et al. (2004) Potent antitumor activity of interleukin-27. Cancer Res. 64(3): 1152-6.
  • Larousserie F, et al. (2005) Analysis of interleukin-27 (EBI3/p28) expression in Epstein-Barr virus- and human T-cell leukemia virus type 1-associated lymphomas: heterogeneous expression of EBI3 subunit by tumoral cells. Am J Pathol. 166(4): 1217-28.
  • Seita J, et al. (2008) Interleukin-27 directly induces differentiation in hematopoietic stem cells. Blood. 111(4): 1903-12.
  • Size / Price
    Catalog: MG51107-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"