Quick Order

Mouse IL25 / IL17E ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse IL25 cDNA Clone Product Information
NCBI RefSeq:NM_080729.2
RefSeq ORF Size:510bp
cDNA Description:Full length Clone DNA of Mus musculus interleukin 25 with N terminal His tag.
Gene Synonym:Il17e, IL-17, IL-25
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:pCMV3-His-mIL25
Restriction Site:HindIII + XbaI (6kb + 0.53kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse IL25 Gene Plasmid Map
Mouse IL25 / IL17E ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Interleukin-25 (IL-25) is a cytokine that shares sequence similarity with interleukin 17. This cytokine can induce NF-kappaB activation, and stimulate the production of interleukin 8. Both this cytokine and interleukin 17B are ligands for the cytokine receptor IL17BR. IL-25 is a member of the IL-17 family of cytokines. However, unlike the other members of this family, IL-25 promotes T helper (Th) 2 responses. IL-25 also regulates the development of autoimmune inflammation mediated by IL-17–producing T cells. IL-25 and IL-17, being members of the same cytokine family, play opposing roles in the pathogenesis of organ-specific autoimmunity. IL-25 promotes cell expansion and Th2 cytokine production when Th2 central memory cells are stimulated with thymic stromal lymphopoietin (TSLP)–activated dendritic cells (DCs), homeostatic cytokines, or T cell receptor for antigen triggering. Elevated expression of IL-25 and IL-25R transcripts was observed in asthmatic lung tissues and atopic dermatitis skin lesions, linking their possible roles with exacerbated allergic disorders. A plausible explanation that IL-25 produced by innate effector eosinophils and basophils may augment the allergic inflammation by enhancing the maintenance and functions of adaptive Th2 memory cells had been provided.

References
  • Rickel EA, et al.. (2008) Identification of functional roles for both IL-17RB and IL-17RA in mediating IL-25-induced activities. J Immunol. 181(6): 4299-310.
  • Tamachi T, et al.. (2006) IL-25 enhances allergic airway inflammation by amplifying a TH2 cell-dependent pathway in mice. J Allergy Clin Immunol. 118(3): 606-14.
  • Kleinschek MA, et al.. (2007) IL-25 regulates Th17 function in autoimmune inflammation. J Exp Med. 204(1): 161-70.
  • Size / Price
    Catalog: MG50138-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    Images
    • Mouse IL25 / IL17E ORF mammalian expression plasmid, N-His tag
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"