IL23 Receptor cDNA ORF Clone, Mouse, C-His tag

Cat: MG51293-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL23 Receptor Reagents
CRO Services
Product recommended

All IL23 Receptor Reagents
IL23 Receptor cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1980 bp
Description
Full length Clone DNA of Mouse interleukin 23 receptor with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL23 Receptor cDNA ORF Clone, Mouse, C-His tag Alternative Names
IL-23R cDNA ORF Clone, Mouse
IL23 Receptor Background Information

IL23R, also known as IL23 receptor, belongs to the type I cytokine receptor family, Type 2 subfamily. It contains 2 fibronectin type-III domains and is expressed by monocytes, Th1, Th0, NK and dendritic cells. Isoform 1 is specifically expressed in NK cells. IL23R associates with IL12RB1 to form the interleukin-23 receptor. It binds IL23 and mediates T-cells, NK cells and possibly certain macrophage/myeloid cells stimulation probably through activation of the Jak-Stat signaling cascade. IL23 functions in innate and adaptive immunity and may participate in acute response to infection in peripheral tissues. IL23 may be responsible for autoimmune inflammatory diseases and be important for tumorigenesis. Genetic variations in IL23R are associated with inflammatory bowel disease type 17 (IBD17). IBD17 is a chronic, relapsing inflammation of the gastrointestinal tract with a complex etiology. Genetic variations in IL23R also can cause susceptibility to psoriasis type 7.

Full Name
interleukin 23 receptor
References
  • Duerr RH, et al. (2006) A genome-wide association study identifies IL23R as an inflammatory bowel disease gene. Science. 314(5804):1461-3.
  • Cargill M, et al. (2007) A large-scale genetic association study confirms IL12B and leads to the identification of IL23R as psoriasis-risk genes. Am J Hum Genet. 80(2):273-90.
  • Dubinsky MC, et al. (2007) IL-23 receptor (IL-23R) gene protects against pediatric Crohn's disease. Inflamm Bowel Dis. 13(5):511-5.
  • Tremelling M, et al. (2007) IL23R variation determines susceptibility but not disease phenotype in inflammatory bowel disease. Gastroenterology. 132(5):1657-64.
  • IL23 Receptor cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL23 Receptor cDNA ORF Clone in Cloning Vector, Rhesus CG90123-G
    IL23 Receptor cDNA ORF Clone, Rhesus, untagged CG90123-UT
    IL23 Receptor Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90123-ACGLN
    IL23 Receptor cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90123-ACG
    IL23 Receptor cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90123-ACR
    IL23 Receptor cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90123-CF
    IL23 Receptor cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90123-NF
    IL23 Receptor cDNA ORF Clone, Rhesus, C-His tag CG90123-CH
    IL23 Receptor cDNA ORF Clone, Rhesus, N-His tag CG90123-NH
    IL23 Receptor cDNA ORF Clone, Rhesus, C-HA tag CG90123-CY
    IL23 Receptor cDNA ORF Clone, Rhesus, N-HA tag CG90123-NY
    IL23 Receptor cDNA ORF Clone, Rhesus, C-Myc tag CG90123-CM
    IL23 Receptor cDNA ORF Clone, Rhesus, N-Myc tag CG90123-NM

    IL23 Receptor cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL23 Receptor cDNA ORF Clone in Cloning Vector, Rat RG80395-G
    IL23 Receptor cDNA ORF Clone, Rat, untagged RG80395-UT
    IL23 Receptor Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80395-ACGLN
    IL23 Receptor cDNA ORF Clone, Rat, C-GFPSpark® tag RG80395-ACG
    IL23 Receptor cDNA ORF Clone, Rat, C-OFPSpark® tag RG80395-ACR
    IL23 Receptor cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80395-CF
    IL23 Receptor cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80395-NF
    IL23 Receptor cDNA ORF Clone, Rat, C-His tag RG80395-CH
    IL23 Receptor cDNA ORF Clone, Rat, N-His tag RG80395-NH
    IL23 Receptor cDNA ORF Clone, Rat, C-HA tag RG80395-CY
    IL23 Receptor cDNA ORF Clone, Rat, N-HA tag RG80395-NY
    IL23 Receptor cDNA ORF Clone, Rat, C-Myc tag RG80395-CM
    IL23 Receptor cDNA ORF Clone, Rat, N-Myc tag RG80395-NM
    IL23 Receptor qPCR Primer Pairs, Rat RP300361

    IL23 Receptor cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL23 Receptor cDNA ORF Clone in Cloning Vector, Mouse MG51293-G
    IL23 Receptor cDNA ORF Clone, Mouse, untagged MG51293-UT
    IL23 Receptor cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51293-ACG
    IL23 Receptor Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51293-ACGLN
    IL23 Receptor cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51293-ACR
    IL23 Receptor cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51293-CF
    IL23 Receptor cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51293-NF
    IL23 Receptor cDNA ORF Clone, Mouse, N-His tag MG51293-NH
    IL23 Receptor cDNA ORF Clone, Mouse, C-HA tag MG51293-CY
    IL23 Receptor cDNA ORF Clone, Mouse, N-HA tag MG51293-NY
    IL23 Receptor cDNA ORF Clone, Mouse, C-Myc tag MG51293-CM
    IL23 Receptor cDNA ORF Clone, Mouse, N-Myc tag MG51293-NM
    IL23 Receptor qPCR Primer Pairs, Mouse MP201174

    IL23 Receptor cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL23 Receptor cDNA ORF Clone in Cloning Vector, Human HG13840-G
    IL23 Receptor cDNA ORF Clone, Human, untagged HG13840-UT
    IL23 Receptor Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13840-ACGLN
    IL23 Receptor cDNA ORF Clone, Human, C-GFPSpark® tag HG13840-ACG
    IL23 Receptor cDNA ORF Clone, Human, C-OFPSpark® tag HG13840-ACR
    IL23 Receptor cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13840-CF
    IL23 Receptor cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13840-NF
    IL23 Receptor cDNA ORF Clone, Human, C-His tag HG13840-CH
    IL23 Receptor cDNA ORF Clone, Human, N-His tag HG13840-NH
    IL23 Receptor cDNA ORF Clone, Human, C-HA tag HG13840-CY
    IL23 Receptor cDNA ORF Clone, Human, N-HA tag HG13840-NY
    IL23 Receptor cDNA ORF Clone, Human, C-Myc tag HG13840-CM
    IL23 Receptor cDNA ORF Clone, Human, N-Myc tag HG13840-NM
    IL23 Receptor qPCR Primer Pairs, Human HP102512
    info info
    添加购物车成功! 添加购物车失败!