IL22 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51085-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL22 Reagents
CRO Services
Product recommended

All IL22 Reagents
IL22 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
528 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 138A/G not causing the amino acid variation.
Description
Full length Clone DNA of Mouse interleukin 22 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.53kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
IL22 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL22 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Validated Images
Mouse IL22 / Interleukin 22 Gene Expression validated Image 2264
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Rhesus CD64/Fc gamma RI Gene Plasmid Map 5614
IL22 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
IL-22 cDNA ORF Clone, Mouse;IL-22a cDNA ORF Clone, Mouse;Iltif cDNA ORF Clone, Mouse;ILTIFa cDNA ORF Clone, Mouse
IL22 Background Information

IL22 is a member of a group of cytokines called the IL-10 family or IL-10 superfamily (including IL-19, IL-20, IL-24, and IL-26),  a class of potent mediators of cellular inflammatory responses. It shares use of IL-10R2 in cell signaling with other members of this family, IL-10, IL-26, IL-28A/B and IL-29. IL22 is produced by activated DC and T cells and initiates innate immune responses against bacterial pathogens especially in epithelial cells such as respiratory and gut epithelial cells. IL22 along with IL-17 is rapidly produced by splenic LTi-like cells and can be also produced by Th17 cells and likely plays a role in the coordinated response of both adaptive and innate immune systems.

IL22 biological activity is initiated by binding to a cell-surface complex composed of IL-22R1 and IL-10R2 receptor chains and further regulated by interactions with a soluble binding protein, IL-22BP, which shares sequence similarity with an extracellular region of IL-22R1 (sIL-22R1). IL22 and IL-10 receptor chains play a role in cellular targeting and signal transduction to selectively initiate and regulate immune responses. IL22 can contribute to immune disease through the stimulation of inflammatory responses, S100s and defensins. IL22 also promotes hepatocyte survival in the liver and epithelial cells in the lung and gut similar to IL-10. In some contexts, the pro-inflammatory versus tissue-protective functions of IL22 are regulated by the often co-expressed cytokine IL-17A.

Full Name
interleukin 22
References
  • Pestka S. et al., 2004, Annu Rev Immunol. 22: 929-79.
  • Xie MH. et al., 2000, J Biol Chem. 275 (40): 31335-9.
  • Jones BC. et al., 2008, Structure. 16 (9): 1333-44.
  • IL22 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL22 cDNA ORF Clone in Cloning Vector, Rat RG80463-G
    IL22 cDNA ORF Clone, Rat, untagged RG80463-UT
    IL22 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80463-ACGLN
    IL22 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80463-ACG
    IL22 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80463-ACR
    IL22 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80463-CF
    IL22 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80463-NF
    IL22 cDNA ORF Clone, Rat, C-His tag RG80463-CH
    IL22 cDNA ORF Clone, Rat, N-His tag RG80463-NH
    IL22 cDNA ORF Clone, Rat, C-HA tag RG80463-CY
    IL22 cDNA ORF Clone, Rat, N-HA tag RG80463-NY
    IL22 cDNA ORF Clone, Rat, C-Myc tag RG80463-CM
    IL22 cDNA ORF Clone, Rat, N-Myc tag RG80463-NM
    IL22 qPCR Primer Pairs, Rat RP300428

    IL22 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL22 cDNA ORF Clone in Cloning Vector, Mouse MG51085-G
    IL22 cDNA ORF Clone, Mouse, untagged MG51085-UT
    IL22 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51085-ACG
    IL22 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51085-ACGLN
    IL22 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51085-ACR
    IL22 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51085-CF
    IL22 cDNA ORF Clone, Mouse, C-His tag MG51085-CH
    IL22 cDNA ORF Clone, Mouse, N-His tag MG51085-NH
    IL22 cDNA ORF Clone, Mouse, C-HA tag MG51085-CY
    IL22 cDNA ORF Clone, Mouse, N-HA tag MG51085-NY
    IL22 cDNA ORF Clone, Mouse, C-Myc tag MG51085-CM
    IL22 cDNA ORF Clone, Mouse, N-Myc tag MG51085-NM
    IL22 qPCR Primer Pairs, Mouse MP201043

    IL22 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL22 cDNA ORF Clone, Human, untagged HG13059-UT
    IL22 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13059-ACGLN
    IL22 cDNA ORF Clone, Human, C-His tag HG13059-CH
    IL22 qPCR Primer Pairs, Human HP104906
    info info
    添加购物车成功! 添加购物车失败!