IL20RB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG50507-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL20RB Reagents
CRO Services
Product recommended

All IL20RB Reagents
IL20RB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
399 bp
Description
Full length Clone DNA of Mouse interleukin 20 receptor beta with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL20RB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
AV228068 cDNA ORF Clone, Mouse;Fndc6 cDNA ORF Clone, Mouse;Gm186 cDNA ORF Clone, Mouse;Il20R2 cDNA ORF Clone, Mouse
IL20RB Background Information

IL20RB belongs to the type II cytokine receptor family. There are two kinds of type II cytokine receptors : cytokine receptors that bind type I and type II interferons; cytokine receptors that bind members of the interleukin-10 family (interleukin-10, interleukin-20 and interleukin-22). Type II cytokine receptors are similar to type I cytokine receptors except they do not possess the signature sequence WSXWS that is characteristic of type I receptors. They are expressed on the surface of certain cells, which bind and respond to a select group of cytokines. These receptors are related predominantly by sequence similarities in their extracellular portions that are composed of tandem Ig-like domains. The intracellular domain of type II cytokine receptors is typically associated with a tyrosine kinase belonging to the Janus kinase (JAK) family. IL20RB and IL20RA (MIM 605620) form a heterodimeric receptor for interleukin-20.

Full Name
interleukin 20 receptor beta
References
  • Zhu H, et al. (2009) Expression pattern of mda-7/IL-24 receptors in liver cancer cell lines. Hepatobiliary Pancreat Dis Int. 8(4):402-6.
  • Logsdon NJ, et al. (2012) Purification, crystallization and preliminary X-ray diffraction analysis of the IL-20-IL-20R1-IL-20R2 complex. Acta Crystallogr Sect F Struct Biol Cryst Commun. 68(Pt 1):89-92.
  • Kingo K, et al. (2008) Association analysis of IL20RA and IL20RB genes in psoriasis. Genes Immun. 9(5):445-51.
  • IL20RB cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL20RB cDNA ORF Clone in Cloning Vector, Rhesus CG90308-G
    IL20RB cDNA ORF Clone, Rhesus, untagged CG90308-UT
    IL20RB cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90308-ACG
    IL20RB Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90308-ACGLN
    IL20RB cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90308-ACR
    IL20RB cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90308-CF
    IL20RB cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90308-NF
    IL20RB cDNA ORF Clone, Rhesus, C-His tag CG90308-CH
    IL20RB cDNA ORF Clone, Rhesus, N-His tag CG90308-NH
    IL20RB cDNA ORF Clone, Rhesus, C-HA tag CG90308-CY
    IL20RB cDNA ORF Clone, Rhesus, N-HA tag CG90308-NY
    IL20RB cDNA ORF Clone, Rhesus, C-Myc tag CG90308-CM
    IL20RB cDNA ORF Clone, Rhesus, N-Myc tag CG90308-NM

    IL20RB cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL20RB cDNA ORF Clone in Cloning Vector, Rat RG80187-G
    IL20RB cDNA ORF Clone, Rat, untagged RG80187-UT
    IL20RB Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80187-ACGLN
    IL20RB cDNA ORF Clone, Rat, C-GFPSpark® tag RG80187-ACG
    IL20RB cDNA ORF Clone, Rat, C-OFPSpark® tag RG80187-ACR
    IL20RB cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80187-CF
    IL20RB cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80187-NF
    IL20RB cDNA ORF Clone, Rat, C-His tag RG80187-CH
    IL20RB cDNA ORF Clone, Rat, N-His tag RG80187-NH
    IL20RB cDNA ORF Clone, Rat, C-HA tag RG80187-CY
    IL20RB cDNA ORF Clone, Rat, N-HA tag RG80187-NY
    IL20RB cDNA ORF Clone, Rat, C-Myc tag RG80187-CM
    IL20RB cDNA ORF Clone, Rat, N-Myc tag RG80187-NM
    IL20RB qPCR Primer Pairs, Rat RP300179

    IL20RB cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL20RB cDNA ORF Clone in Cloning Vector, Mouse MG50507-M
    IL20RB cDNA ORF Clone, Mouse, untagged MG50507-UT
    IL20RB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50507-ACG
    IL20RB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50507-ACGLN
    IL20RB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50507-ACR
    IL20RB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50507-CF
    IL20RB cDNA ORF Clone, Mouse, C-His tag MG50507-CH
    IL20RB cDNA ORF Clone, Mouse, N-His tag MG50507-NH
    IL20RB cDNA ORF Clone, Mouse, C-HA tag MG50507-CY
    IL20RB cDNA ORF Clone, Mouse, N-HA tag MG50507-NY
    IL20RB cDNA ORF Clone, Mouse, C-Myc tag MG50507-CM
    IL20RB cDNA ORF Clone, Mouse, N-Myc tag MG50507-NM
    IL20RB qPCR Primer Pairs, Mouse MP200500

    IL20RB cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL20RB cDNA ORF Clone, Human, untagged HG29609-UT
    IL20RB cDNA ORF Clone, Human, C-GFPSpark® tag HG29609-ACG
    IL20RB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29609-ACGLN
    IL20RB cDNA ORF Clone, Human, C-OFPSpark® tag HG29609-ACR
    IL20RB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG29609-CF
    IL20RB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG29609-NF
    IL20RB cDNA ORF Clone, Human, C-His tag HG29609-CH
    IL20RB cDNA ORF Clone, Human, N-His tag HG29609-NH
    IL20RB cDNA ORF Clone, Human, C-HA tag HG29609-CY
    IL20RB cDNA ORF Clone, Human, N-HA tag HG29609-NY
    IL20RB cDNA ORF Clone, Human, C-Myc tag HG29609-CM
    IL20RB cDNA ORF Clone, Human, N-Myc tag HG29609-NM
    IL20RB qPCR Primer Pairs, Human HP101815
    info info
    添加购物车成功! 添加购物车失败!