Quick Order

Mouse IL-1RA/IL1RN Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse IL1RN cDNA Clone Product Information
NCBI RefSeq:NM_001039701.3
RefSeq ORF Size:537bp
cDNA Description:Full length Clone DNA of Mus musculus interleukin 1 receptor antagonist with C terminal HA tag.
Gene Synonym:IL-1ra, F630041P17Rik
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Interleukin-1 receptor antagonist (IL-1RA) also known as IL1RN is a member of the interleukin 1 cytokine family. This protein inhibits the activities of interleukin 1, alpha (IL1A) and interleukin 1, beta (IL1B), and modulates a variety of interleukin 1 related immune and inflammatory responses. A polymorphism of this protein encoding gene is reported to be associated with increased risk of osteoporotic fractures and gastric cancer. IL-1RA/IL1RN may inhibit the activity of IL-1 by binding to its receptor and it has no IL-1 like activity. Genetic variation in IL-1RA/IL1RN is associated with susceptibility to microvascular complications of diabetes type 4 (MVCD4). These are pathological conditions that develop in numerous tissues and organs as a consequence of diabetes mellitus. They include diabetic retinopathy, diabetic nephropathy leading to end-stage renal disease, and diabetic neuropathy. Diabetic retinopathy remains the major cause of new-onset blindness among diabetic adults. It is characterized by vascular permeability and increased tissue ischemia and angiogenesis. Defects in IL-1RA/IL1RN are the cause of interleukin 1 receptor antagonist deficiency (DIRA) which is also known as deficiency of interleukin 1 receptor antagonist. Autoinflammatory diseases manifest inflammation without evidence of infection, high-titer autoantibodies, or autoreactive T-cells. DIRA is a rare, autosomal recessive, genetic autoinflammatory disease that results in sterile multifocal osteomyelitis, and pustulosis from birth.

References
  • Langdahl BL, et al. (2000) Osteoporotic fractures are associated with an 86-base pair repeat polymorphism in the interleukin-1--receptor antagonist gene but not with polymorphisms in the interleukin-1beta gene. J Bone Miner. 15 (3): 402-14.
  • El-Omar EM, et al. (2000) Interleukin-1 polymorphisms associated with increased risk of gastric cancer. Nature. 404 (6776): 398-402.
  • Steinkasserer A, et al. (1992) The human IL-1 receptor antagonist gene (IL1RN) maps to chromosome 2q14-q21, in the region of the IL-1 alpha and IL-1 beta loci. Genomics. 13 (3): 654-7.
  • Size / Price
    Catalog: MG51300-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"