After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse IL-1RAcP/IL-1R3 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse IL1RAP cDNA Clone Product Information
NCBI RefSeq:NM_134103.2
RefSeq ORF Size:1083bp
cDNA Description:Full length Clone DNA of Mus musculus interleukin 1 receptor accessory protein with N terminal His tag.
Gene Synonym:AI255955, AV239853, IL-1RAcP, 6430709H04Rik
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Interleukin-1 receptor accessory protein (IL-1RAcP) also known as Interleukin-1 receptor member 3 (IL-1R3) is a a cytokine receptor which binds interleukin 1. The IL-1 receptor accessory protein (IL1RAP) is a transmembrane protein that interacts with IL-1R and is required for IL-1 signal transduction. Interleukin 1 induces synthesis of acute phase and proinflammatory proteins during infection, tissue damage, or stress, by forming a complex at the cell membrane with an interleukin 1 receptor and an accessory protein. IL-1RAcP/IL-1R3 is a necessary part of the interleukin 1 receptor complex which initiates signalling events that result in the activation of interleukin 1-responsive genes. Alternative splicing of this gene results in two transcript variants encoding two different isoforms, one membrane-bound and one soluble. The ratio of soluble to membrane-bound forms increases during acute-phase induction or stress. IL-1RAcP/IL-1R3 mediates interleukin-1-dependent activation of NF-kappa-B. Isoform 1 is part of the membrane-bound form of the IL-1 receptor. Signaling involves formation of a ternary complex containing IL1R1, TOLLIP, MYD88, and IRAK1 or IRAK2. Isoform 2 modulates the response to interleukins by associating with soluble IL1R1 and enhancing interleukin-binding to the decoy receptor.

References
  • Goldbach-Mansky R, et al. (2009) Autoinflammation: the prominent role of IL-1 in monogenic autoinflammatory diseases and implications for common illnesses. J Allergy Clin Immunol. 124(6): 1141-9.
  • Johnston A, et al. (2011) IL-1F5, -F6, -F8, and -F9: a novel IL-1 family signaling system that is active in psoriasis and promotes keratinocyte antimicrobial peptide expression. J Immunol. 186(4): 2613-22.
  • Ozaki K, et al. (2001) Effect of tumor weight and tube feeding on TNF-alpha and IL-1beta mRNA expression in the brain of mice. JPEN J Parenter Enteral Nutr. 25(6): 317-22.
  • Size / Price
    Catalog: MG52657-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"