IL1R1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50807-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL1R1 Reagents
CRO Services
Product recommended

All IL1R1 Reagents
IL1R1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1731 bp
Description
Full length Clone DNA of Mouse interleukin 1 receptor, type I with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL1R1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
CD121a cDNA ORF Clone, Mouse;CD121b cDNA ORF Clone, Mouse;IL-1R1 cDNA ORF Clone, Mouse;IL-iR cDNA ORF Clone, Mouse;Il1r-1 cDNA ORF Clone, Mouse
IL1R1 Background Information

Interleukin 1 receptor, type I (IL-1R1) also known as CD121a (Cluster of Differentiation 121a), is an interleukin receptor. IL-1R1/CD121a is a cytokine receptor that belongs to the interleukin 1 receptor family. This protein is a receptor for interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I (IL1R1/IL1RA). IL-1R1/CD121a is an important mediator involved in many cytokine induced immune and inflammatory responses. This protein has been characterized by pharmacological and molecular techniques in the mouse brain. The spindle-shaped astrocytes enclose the wound, separating the healthy from damaged neural tissue. The shape change and subsequent repair processes are IL-1β activity-dependent, acting through the IL-1 type 1 receptor (IL-1R1), as co-application of the IL-1type 1 receptor antagonist protein (IL-1ra) blocks IL-1β induced effects. In the spleen, a slight increase in IL-1R AcP and IL-1R1 was observed during the first hours following LPS stimulation. In conclusion, IL-1R AcP mRNA is expressed in the brain and in other tissues where IL-1R1/CD121a transcripts are found. However, the regulation of its expression is distinct from IL-1R1/CD121a. The high level of expression and the lack of regulation of IL-1R AcP transcripts in the brain under inflammatory conditions suggest that the protein might be constitutively expressed in excess.

Full Name
interleukin 1 receptor, type I
References
  • Dale M, et al. (1999). "Interleukin-1 receptor cluster: gene organization of IL1R2, IL1R1, IL1RL2 (IL-1Rrp2), IL1RL1 (T1/ST2), and IL18R1 (IL-1Rrp) on human chromosome 2q.". Genomics 57 (1): 177-9.
  • Joos L, et al. (2001). "Association of IL-1beta and IL-1 receptor antagonist haplotypes with rate of decline in lung function in smokers.". Thorax 56 (11): 863-6.
  • Vigers GP, et al. (1997). "Crystal structure of the type-I interleukin-1 receptor complexed with interleukin-1beta.". Nature 386 (6621): 190-4.
  • IL1R1 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL1R1 cDNA ORF Clone in Cloning Vector, Rhesus CG90279-G
    IL1R1 cDNA ORF Clone, Rhesus, untagged CG90279-UT
    IL1R1 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90279-ACGLN
    IL1R1 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90279-ACG
    IL1R1 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90279-ACR
    IL1R1 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90279-CF
    IL1R1 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90279-NF
    IL1R1 cDNA ORF Clone, Rhesus, C-His tag CG90279-CH
    IL1R1 cDNA ORF Clone, Rhesus, N-His tag CG90279-NH
    IL1R1 cDNA ORF Clone, Rhesus, C-HA tag CG90279-CY
    IL1R1 cDNA ORF Clone, Rhesus, N-HA tag CG90279-NY
    IL1R1 cDNA ORF Clone, Rhesus, C-Myc tag CG90279-CM
    IL1R1 cDNA ORF Clone, Rhesus, N-Myc tag CG90279-NM

    IL1R1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL1R1 cDNA ORF Clone in Cloning Vector, Rat RG80028-M
    IL1R1 cDNA ORF Clone, Rat, untagged RG80028-UT
    IL1R1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80028-ACGLN
    IL1R1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80028-ACG
    IL1R1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80028-ACR
    IL1R1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80028-CF
    IL1R1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80028-NF
    IL1R1 cDNA ORF Clone, Rat, C-His tag RG80028-CH
    IL1R1 cDNA ORF Clone, Rat, N-His tag RG80028-NH
    IL1R1 cDNA ORF Clone, Rat, C-HA tag RG80028-CY
    IL1R1 cDNA ORF Clone, Rat, N-HA tag RG80028-NY
    IL1R1 cDNA ORF Clone, Rat, C-Myc tag RG80028-CM
    IL1R1 cDNA ORF Clone, Rat, N-Myc tag RG80028-NM
    IL1R1 qPCR Primer Pairs, Rat RP300027

    IL1R1 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL1R1 cDNA ORF Clone in Cloning Vector, Mouse MG50807-G
    IL1R1 cDNA ORF Clone, Mouse, untagged MG50807-UT
    IL1R1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50807-ACGLN
    IL1R1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50807-ACG
    IL1R1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50807-ACR
    IL1R1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50807-CF
    IL1R1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50807-NF
    IL1R1 cDNA ORF Clone, Mouse, C-His tag MG50807-CH
    IL1R1 cDNA ORF Clone, Mouse, C-HA tag MG50807-CY
    IL1R1 cDNA ORF Clone, Mouse, N-HA tag MG50807-NY
    IL1R1 cDNA ORF Clone, Mouse, C-Myc tag MG50807-CM
    IL1R1 cDNA ORF Clone, Mouse, N-Myc tag MG50807-NM
    IL1R1 qPCR Primer Pairs, Mouse MP200778

    IL1R1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL1R1 cDNA ORF Clone in Cloning Vector, Human HG10126-M
    IL1R1 cDNA ORF Clone, Human, untagged HG10126-UT
    IL1R1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10126-ACG
    IL1R1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10126-ACGLN
    IL1R1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10126-ACR
    IL1R1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10126-CF
    IL1R1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10126-NF
    IL1R1 cDNA ORF Clone, Human, C-His tag HG10126-CH
    IL1R1 cDNA ORF Clone, Human, N-His tag HG10126-NH
    IL1R1 cDNA ORF Clone, Human, C-HA tag HG10126-CY
    IL1R1 cDNA ORF Clone, Human, N-HA tag HG10126-NY
    IL1R1 cDNA ORF Clone, Human, C-Myc tag HG10126-CM
    IL1R1 cDNA ORF Clone, Human, N-Myc tag HG10126-NM
    IL1R1 qPCR Primer Pairs, Human HP100199
    info info
    添加购物车成功! 添加购物车失败!