Quick Order

Text Size:AAA

Mouse IL1R1/IL-1R1/IL-1 RI Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse IL1R1 cDNA Clone Product Information
NCBI RefSeq:NM_008362.2
RefSeq ORF Size:1731bp
cDNA Description:Full length Clone DNA of Mus musculus interleukin 1 receptor, type I with N terminal His tag.
Gene Synonym:CD121a, CD121b, Il1r-1, MGC129154
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Interleukin 1 receptor, type I (IL-1R1) also known as CD121a (Cluster of Differentiation 121a), is an interleukin receptor. IL-1R1/CD121a is a cytokine receptor that belongs to the interleukin 1 receptor family. This protein is a receptor for interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I (IL1R1/IL1RA). IL-1R1/CD121a is an important mediator involved in many cytokine induced immune and inflammatory responses. This protein has been characterized by pharmacological and molecular techniques in the mouse brain. The spindle-shaped astrocytes enclose the wound, separating the healthy from damaged neural tissue. The shape change and subsequent repair processes are IL-1β activity-dependent, acting through the IL-1 type 1 receptor (IL-1R1), as co-application of the IL-1type 1 receptor antagonist protein (IL-1ra) blocks IL-1β induced effects. In the spleen, a slight increase in IL-1R AcP and IL-1R1 was observed during the first hours following LPS stimulation. In conclusion, IL-1R AcP mRNA is expressed in the brain and in other tissues where IL-1R1/CD121a transcripts are found. However, the regulation of its expression is distinct from IL-1R1/CD121a. The high level of expression and the lack of regulation of IL-1R AcP transcripts in the brain under inflammatory conditions suggest that the protein might be constitutively expressed in excess.

References
  • Dale M, et al. (1999). "Interleukin-1 receptor cluster: gene organization of IL1R2, IL1R1, IL1RL2 (IL-1Rrp2), IL1RL1 (T1/ST2), and IL18R1 (IL-1Rrp) on human chromosome 2q.". Genomics 57 (1): 177-9.
  • Joos L, et al. (2001). "Association of IL-1beta and IL-1 receptor antagonist haplotypes with rate of decline in lung function in smokers.". Thorax 56 (11): 863-6.
  • Vigers GP, et al. (1997). "Crystal structure of the type-I interleukin-1 receptor complexed with interleukin-1beta.". Nature 386 (6621): 190-4.
  • Size / Price
    Catalog: MG50807-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"