Quick Order

Mouse IL1F10 / IL-38 Gene ORF cDNA clone expression plasmid, C-His tag

  • other Green fluorescent protein / GFP Gene Plasmid Map 5610
DatasheetReviewsRelated ProductsProtocols
Mouse IL1F10 cDNA Clone Product Information
NCBI RefSeq:NM_153077.2
RefSeq ORF Size:504 bp
cDNA Description:Full length Clone DNA of Mus musculus interleukin 1 family, member 10 with C terminal His tag.
Gene Synonym:RP23-176J12.7, IL1F10
Species:Mouse
Vector:pCMV3-C-His
Plasmid:pCMV3-mIL1F10-His
Restriction Site:KpnI + XbaI(6kb+0.5kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IL1F10 qPCR primers for gene expression analysis, MP201179 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Flow cytometric analysis of Human IL17RA(CD217) expression on human whole blood granulocytes. Cells were stained with FITC-conjugated anti-Human IL17RA(CD217). The fluorescence histograms were derived from gated events with the forward and side light-scatter characteristics of viable granulocytes.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Size / Price
Catalog: MG51301-CH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"