IL18RAP cDNA ORF Clone, Mouse, N-His tag

Cat: MG50845-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL18RAP Reagents
CRO Services
Product recommended

All IL18RAP Reagents
IL18RAP cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1845 bp
Description
Full length Clone DNA of Mouse interleukin 18 receptor accessory protein with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL18RAP cDNA ORF Clone, Mouse, N-His tag Alternative Names
AcPL cDNA ORF Clone, Mouse;IL-18R-beta cDNA ORF Clone, Mouse;IL-18RAcP cDNA ORF Clone, Mouse;IL-18Rbeta cDNA ORF Clone, Mouse;IL-1RAcPL cDNA ORF Clone, Mouse
IL18RAP Background Information

Interleukin 18 receptor accessory protein, also known as IL18RAP and CDw218b (cluster of differentiation w218b), is an accessory subunit of the heterodimeric receptor for IL18. This protein enhances the IL18 binding activity of IL18R1 (IL1RRP), a ligand binding subunit of IL18 receptor. The coexpression of IL18R1 and this protein is required for the activation of NF-kappaB and MAPK8 (JNK) in response to IL18. IL18RAP is required for the high affinity binding of interleukin 18 (IL-18) to its receptor complex. IL18RAP together with IL18R1 mediates IL-18-dependent activation of NF-kappa-B and JNK. Two putative isoforms of IL18RAP were detected and the ratios and total levels of these isoforms may contribute to the aetiology of coeliac disease. IL18R1 and IL18RAP polymorphisms have been found associated with diseases such as schizophrenia, HSV1 seropositivity and atopic asthma. Analysis of IL18R1 and IL18RAP SNPs in 5 European prospective cohorts suggests that the variability of these genes are unlikely to contribute to modulate the risk of CVD in European populations.

Full Name
interleukin 18 receptor accessory protein
References
  • Zhernakova A, et al.. (2008) Genetic analysis of innate immunity in Crohn's disease and ulcerative colitis identifies two susceptibility loci harboring CARD9 and IL18RAP. Am J Hum Genet. 82(5): 1202-10.
  • Grisoni ML, et al.. (2009) Lack of association between polymorphisms of the IL18R1 and IL18RAP genes and cardiovascular risk: the MORGAM Project. BMC Med Genet. 10: 44.
  • Koskinen LL, et al.. (2009) Association study of the IL18RAP locus in three European populations with coeliac disease. Hum Mol Genet. 18(6): 1148-55.
  • IL18RAP cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL18RAP cDNA ORF Clone in Cloning Vector, Rhesus CG90122-G
    IL18RAP cDNA ORF Clone, Rhesus, untagged CG90122-UT
    IL18RAP Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90122-ACGLN
    IL18RAP cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90122-ACG
    IL18RAP cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90122-ACR
    IL18RAP cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90122-CF
    IL18RAP cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90122-NF
    IL18RAP cDNA ORF Clone, Rhesus, C-His tag CG90122-CH
    IL18RAP cDNA ORF Clone, Rhesus, N-His tag CG90122-NH
    IL18RAP cDNA ORF Clone, Rhesus, C-HA tag CG90122-CY
    IL18RAP cDNA ORF Clone, Rhesus, N-HA tag CG90122-NY
    IL18RAP cDNA ORF Clone, Rhesus, C-Myc tag CG90122-CM
    IL18RAP cDNA ORF Clone, Rhesus, N-Myc tag CG90122-NM

    IL18RAP cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL18RAP cDNA ORF Clone in Cloning Vector, Mouse MG50845-G
    IL18RAP cDNA ORF Clone, Mouse, untagged MG50845-UT
    IL18RAP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50845-ACGLN
    IL18RAP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50845-ACG
    IL18RAP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50845-ACR
    IL18RAP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50845-CF
    IL18RAP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50845-NF
    IL18RAP cDNA ORF Clone, Mouse, C-His tag MG50845-CH
    IL18RAP cDNA ORF Clone, Mouse, C-HA tag MG50845-CY
    IL18RAP cDNA ORF Clone, Mouse, N-HA tag MG50845-NY
    IL18RAP cDNA ORF Clone, Mouse, C-Myc tag MG50845-CM
    IL18RAP cDNA ORF Clone, Mouse, N-Myc tag MG50845-NM
    IL18RAP qPCR Primer Pairs, Mouse MP200816

    IL18RAP cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL18RAP cDNA ORF Clone in Cloning Vector, Human HG10176-M
    IL18RAP cDNA ORF Clone, Human, untagged HG10176-UT
    IL18RAP cDNA ORF Clone, Human, C-GFPSpark® tag HG10176-ACG
    IL18RAP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10176-ACGLN
    IL18RAP cDNA ORF Clone, Human, C-OFPSpark® tag HG10176-ACR
    IL18RAP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10176-CF
    IL18RAP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10176-NF
    IL18RAP cDNA ORF Clone, Human, C-His tag HG10176-CH
    IL18RAP cDNA ORF Clone, Human, N-His tag HG10176-NH
    IL18RAP cDNA ORF Clone, Human, C-HA tag HG10176-CY
    IL18RAP cDNA ORF Clone, Human, N-HA tag HG10176-NY
    IL18RAP cDNA ORF Clone, Human, C-Myc tag HG10176-CM
    IL18RAP cDNA ORF Clone, Human, N-Myc tag HG10176-NM
    IL18RAP qPCR Primer Pairs, Human HP100244
    info info
    添加购物车成功! 添加购物车失败!