IL15RA cDNA ORF Clone, Mouse, C-His tag

Cat: MG51292-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IL15RA Reagents
CRO Services
Product recommended

All IL15RA Reagents
IL15RA cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
792 bp
Description
Full length Clone DNA of Mouse interleukin 15 receptor,alphachain with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL15RA cDNA ORF Clone, Mouse, C-His tag Alternative Names
AA690181 cDNA ORF Clone, Mouse;IL-15RA cDNA ORF Clone, Mouse
IL15RA Background Information
Full Name
interleukin 15 receptor, alpha

IL15RA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IL15RA cDNA ORF Clone in Cloning Vector, Mouse MG51292-G
IL15RA cDNA ORF Clone, Mouse, untagged MG51292-UT
IL15RA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51292-ACGLN
IL15RA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51292-ACG
IL15RA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51292-ACR
IL15RA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51292-CF
IL15RA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51292-NF
IL15RA cDNA ORF Clone, Mouse, N-His tag MG51292-NH
IL15RA cDNA ORF Clone, Mouse, C-HA tag MG51292-CY
IL15RA cDNA ORF Clone, Mouse, N-HA tag MG51292-NY
IL15RA cDNA ORF Clone, Mouse, C-Myc tag MG51292-CM
IL15RA cDNA ORF Clone, Mouse, N-Myc tag MG51292-NM
IL15RA qPCR Primer Pairs, Mouse MP201173

IL15RA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IL15RA cDNA ORF Clone in Cloning Vector, Human HG18366-G
IL15RA cDNA ORF Clone, Human, untagged HG29736-UT
IL15RA cDNA ORF Clone, Human, untagged HG18366-UT
IL15RA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18366-ACGLN
IL15RA cDNA ORF Clone, Human, C-GFPSpark® tag HG18366-ACG
IL15RA cDNA ORF Clone, Human, C-OFPSpark® tag HG18366-ACR
IL15RA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG18366-CF
IL15RA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG18366-NF
IL15RA cDNA ORF Clone, Human, C-His tag HG18366-CH
IL15RA cDNA ORF Clone, Human, N-His tag HG18366-NH
IL15RA cDNA ORF Clone, Human, C-HA tag HG18366-CY
IL15RA cDNA ORF Clone, Human, N-HA tag HG18366-NY
IL15RA cDNA ORF Clone, Human, C-Myc tag HG18366-CM
IL15RA cDNA ORF Clone, Human, N-Myc tag HG18366-NM
info info
添加购物车成功! 添加购物车失败!