IL-12 p70 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50662-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL-12 p70 Reagents
CRO Services
Product recommended

All IL-12 p70 Reagents
IL-12 p70 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
648 bp
Description
Full length Clone DNA of Mouse interleukin 12a with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-12 p70 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
Il-12a cDNA ORF Clone, Mouse;IL-12p35 cDNA ORF Clone, Mouse;Ll12a cDNA ORF Clone, Mouse;p35 cDNA ORF Clone, Mouse
IL-12 p70 Background Information

Interleukin-12 subunit alpha (IL12A/IL-12p35) is also known as Cytotoxic lymphocyte maturation factor 35 kDa subunit, cytotoxic lymphocyte maturation factor 1, p35, NK cell stimulatory factor chain 1, and interleukin-12 alpha chain. IL12A/IL-12p35 is a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. IL12A/IL-12p35 is required for the T-cell-independent induction of IFN-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. In clinical, IL-12 remains a very promising immunotherapeutic agent because recent cancer vaccination studies in animal models and humans have demonstrated its powerful adjuvant properties. The immune modulating characteristics of IL-12 considered responsible for the adjuvant effects, as well as the results of animal and human cancer vaccination studies with IL-12 applied as an adjuvant. IL12A/IL-12p35 indicates a cytokine which is important in the development of prostate cancer.

Full Name
interleukin 12A
References
  • Sattler HP, et al. (2000) Novel amplification unit at chromosome 3q25-q27 in human prostate cancer. Prostate. 45(3): 207-15.
  • Lamont AG, et al. (1996) IL-12: a key cytokine in immune regulation. Immunol Today. 17(5): 214-7.
  • Portielje JE, et al. (2003) IL-12: a promising adjuvant for cancer vaccination. Cancer Immunol Immunother. 52(3): 133-44.
  • IL-12 p70 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL-12 p70 cDNA ORF Clone in Cloning Vector, Rhesus CG90290-G
    IL-12 p70 cDNA ORF Clone, Rhesus, untagged CG90290-UT
    IL-12 p70 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90290-ACGLN
    IL-12 p70 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90290-ACG
    IL-12 p70 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90290-ACR
    IL-12 p70 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90290-CF
    IL-12 p70 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90290-NF
    IL-12 p70 cDNA ORF Clone, Rhesus, C-His tag CG90290-CH
    IL-12 p70 cDNA ORF Clone, Rhesus, N-His tag CG90290-NH
    IL-12 p70 cDNA ORF Clone, Rhesus, C-HA tag CG90290-CY
    IL-12 p70 cDNA ORF Clone, Rhesus, N-HA tag CG90290-NY
    IL-12 p70 cDNA ORF Clone, Rhesus, C-Myc tag CG90290-CM
    IL-12 p70 cDNA ORF Clone, Rhesus, N-Myc tag CG90290-NM

    IL-12 p70 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL-12 p70 cDNA ORF Clone in Cloning Vector, Rat RG80078-M
    IL-12 p70 cDNA ORF Clone, Rat, untagged RG80078-UT
    IL-12 p70 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80078-ACGLN
    IL-12 p70 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80078-ACG
    IL-12 p70 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80078-ACR
    IL-12 p70 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80078-CF
    IL-12 p70 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80078-NF
    IL-12 p70 cDNA ORF Clone, Rat, C-His tag RG80078-CH
    IL-12 p70 cDNA ORF Clone, Rat, N-His tag RG80078-NH
    IL-12 p70 cDNA ORF Clone, Rat, C-HA tag RG80078-CY
    IL-12 p70 cDNA ORF Clone, Rat, N-HA tag RG80078-NY
    IL-12 p70 cDNA ORF Clone, Rat, C-Myc tag RG80078-CM
    IL-12 p70 cDNA ORF Clone, Rat, N-Myc tag RG80078-NM
    IL-12 p70 qPCR Primer Pairs, Rat RP300074

    IL-12 p70 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL-12 p70 cDNA ORF Clone in Cloning Vector, Mouse MG50662-G
    IL-12 p70 cDNA ORF Clone in Cloning Vector, Mouse MG51308-G
    IL-12 p70 cDNA ORF Clone, Mouse, untagged MG50662-UT
    IL-12 p70 cDNA ORF Clone, Mouse, untagged MG51308-UT
    IL-12 p70 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51308-ACGLN
    IL-12 p70 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50662-ACGLN
    IL-12 p70 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50662-ACG
    IL-12 p70 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51308-ACG
    IL-12 p70 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50662-ACR
    IL-12 p70 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51308-ACR
    IL-12 p70 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50662-G-F
    IL-12 p70 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51308-CF
    IL-12 p70 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50662-CF
    IL-12 p70 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51308-NF
    IL-12 p70 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50662-NF
    IL-12 p70 cDNA ORF Clone, Mouse, C-His tag MG50662-CH
    IL-12 p70 cDNA ORF Clone, Mouse, C-His tag MG51308-CH
    IL-12 p70 cDNA ORF Clone, Mouse, N-His tag MG50662-NH
    IL-12 p70 cDNA ORF Clone, Mouse, N-His tag MG51308-NH
    IL-12 p70 cDNA ORF Clone, Mouse, C-HA tag MG50662-CY
    IL-12 p70 cDNA ORF Clone, Mouse, C-HA tag MG51308-CY
    IL-12 p70 cDNA ORF Clone, Mouse, N-HA tag MG51308-NY
    IL-12 p70 cDNA ORF Clone, Mouse, C-Myc tag MG51308-CM
    IL-12 p70 cDNA ORF Clone, Mouse, C-Myc tag MG50662-CM
    IL-12 p70 cDNA ORF Clone, Mouse, N-Myc tag MG50662-NM
    IL-12 p70 cDNA ORF Clone, Mouse, N-Myc tag MG51308-NM
    IL-12 p70 qPCR Primer Pairs, Mouse MP200641

    IL-12 p70 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL-12 p70 cDNA ORF Clone in Cloning Vector, Human HG10021-M
    IL-12 p70 cDNA ORF Clone, Human, untagged HG10021-UT
    IL-12 p70 cDNA ORF Clone, Human, C-GFPSpark® tag HG10021-ACG
    IL-12 p70 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10021-ACGLN
    IL-12 p70 cDNA ORF Clone, Human, C-OFPSpark® tag HG10021-ACR
    IL-12 p70 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10021-CF
    IL-12 p70 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10021-NF
    IL-12 p70 cDNA ORF Clone, Human, C-His tag HG10021-CH
    IL-12 p70 cDNA ORF Clone, Human, N-His tag HG10021-NH
    IL-12 p70 cDNA ORF Clone, Human, C-HA tag HG10021-CY
    IL-12 p70 cDNA ORF Clone, Human, N-HA tag HG10021-NY
    IL-12 p70 cDNA ORF Clone, Human, C-Myc tag HG10021-CM
    IL-12 p70 cDNA ORF Clone, Human, N-Myc tag HG10021-NM
    IL-12 p70 qPCR Primer Pairs, Human HP100118
    info info
    添加购物车成功! 添加购物车失败!