After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse IL12A / IL-12A Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse IL12A cDNA Clone Product Information
NCBI RefSeq:NM_008351.2
RefSeq ORF Size:648bp
cDNA Description:Full length Clone DNA of Mus musculus interleukin 12a with C terminal Myc tag.
Gene Synonym:p35, Ll12a, Il-12a, IL-12p35, MGC151228, MGC151232
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Interleukin-12 subunit alpha (IL12A/IL-12p35) is also known as Cytotoxic lymphocyte maturation factor 35 kDa subunit, cytotoxic lymphocyte maturation factor 1, p35, NK cell stimulatory factor chain 1, and interleukin-12 alpha chain. IL12A/IL-12p35 is a subunit of a cytokine that acts on T and natural killer cells, and has a broad array of biological activities. The cytokine is a disulfide-linked heterodimer composed of the 35-kD subunit encoded by this gene, and a 40-kD subunit that is a member of the cytokine receptor family. IL12A/IL-12p35 is required for the T-cell-independent induction of IFN-gamma, and is important for the differentiation of both Th1 and Th2 cells. The responses of lymphocytes to this cytokine are mediated by the activator of transcription protein STAT4. Nitric oxide synthase 2A (NOS2A/NOS2) is found to be required for the signaling process of this cytokine in innate immunity. In clinical, IL-12 remains a very promising immunotherapeutic agent because recent cancer vaccination studies in animal models and humans have demonstrated its powerful adjuvant properties. The immune modulating characteristics of IL-12 considered responsible for the adjuvant effects, as well as the results of animal and human cancer vaccination studies with IL-12 applied as an adjuvant. IL12A/IL-12p35 indicates a cytokine which is important in the development of prostate cancer.

References
  • Sattler HP, et al. (2000) Novel amplification unit at chromosome 3q25-q27 in human prostate cancer. Prostate. 45(3): 207-15.
  • Lamont AG, et al. (1996) IL-12: a key cytokine in immune regulation. Immunol Today. 17(5): 214-7.
  • Portielje JE, et al. (2003) IL-12: a promising adjuvant for cancer vaccination. Cancer Immunol Immunother. 52(3): 133-44.
  • Size / Price
    Catalog: MG50662-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"