IL10RB cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50846-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IL10RB Reagents
CRO Services
Product recommended

All IL10RB Reagents
IL10RB cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1057 bp
Description
Full length Clone DNA of Mouse interleukin 10 receptor, beta with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL10RB cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
6620401D04Rik cDNA ORF Clone, Mouse;AI528744 cDNA ORF Clone, Mouse;CRF2-4 cDNA ORF Clone, Mouse;Crfb4 cDNA ORF Clone, Mouse;D16H21S58 cDNA ORF Clone, Mouse;D21S58h cDNA ORF Clone, Mouse;IL-10R2 cDNA ORF Clone, Mouse;Il10r2 cDNA ORF Clone, Mouse
IL10RB Background Information

Interleukin 10 receptor, beta subunit (IL10RB/IL-10RB) also known as Cytokine receptor family 2 member 4, Interleukin-10 receptor subunit 2, and cytokine receptor family II, member 4, is a subunit for the interleukin-10 receptor. IL10RB/IL-10RB belongs to the cytokine receptor family. It is an accessory chain essential for the active interleukin 10 receptor complex. Coexpression of this and IL10RA proteins has been shown to be required for IL10-induced signal transduction. Defects in IL10RB/IL-10RB are the cause of inflammatory bowel disease type 25 (IBD25). It is a chronic, relapsing inflammation of the gastrointestinal tract with a complex etiology. It is subdivided into Crohn disease and ulcerative colitis phenotypes. Crohn disease may affect any part of the gastrointestinal tract from the mouth to the anus, but most frequently it involves the terminal ileum and colon. Bowel inflammation is transmural and discontinuous; it may contain granulomas or be associated with intestinal or perianal fistulas. In contrast, in ulcerative colitis, the inflammation is continuous and limited to rectal and colonic mucosal layers; fistulas and granulomas are not observed. Both diseases include extraintestinal inflammation of the skin, eyes, or joints.

Full Name
interleukin 10 receptor, beta
References
  • Josephson K, et al. (2001) Crystal structure of the IL-10/IL-10R1 complex reveals a shared receptor binding site. Immunity. 15 (1): 35-46.
  • Yoo KH, et al. (2011) Association of IL10, IL10RA, and IL10RB polymorphisms with benign prostate hyperplasia in Korean population. J Korean Med Sci. 26(5): 659-64.
  • IL10RB cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL10RB cDNA ORF Clone in Cloning Vector, Rhesus CG90116-G
    IL10RB cDNA ORF Clone, Rhesus, untagged CG90116-UT
    IL10RB cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90116-ACG
    IL10RB Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90116-ACGLN
    IL10RB cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90116-ACR
    IL10RB cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90116-CF
    IL10RB cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90116-NF
    IL10RB cDNA ORF Clone, Rhesus, C-His tag CG90116-CH
    IL10RB cDNA ORF Clone, Rhesus, N-His tag CG90116-NH
    IL10RB cDNA ORF Clone, Rhesus, C-HA tag CG90116-CY
    IL10RB cDNA ORF Clone, Rhesus, N-HA tag CG90116-NY
    IL10RB cDNA ORF Clone, Rhesus, C-Myc tag CG90116-CM
    IL10RB cDNA ORF Clone, Rhesus, N-Myc tag CG90116-NM

    IL10RB cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL10RB cDNA ORF Clone in Cloning Vector, Rat RG80184-G
    IL10RB cDNA ORF Clone, Rat, untagged RG80184-UT
    IL10RB cDNA ORF Clone, Rat, C-GFPSpark® tag RG80184-ACG
    IL10RB Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80184-ACGLN
    IL10RB cDNA ORF Clone, Rat, C-OFPSpark® tag RG80184-ACR
    IL10RB cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80184-CF
    IL10RB cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80184-NF
    IL10RB cDNA ORF Clone, Rat, C-His tag RG80184-CH
    IL10RB cDNA ORF Clone, Rat, N-His tag RG80184-NH
    IL10RB cDNA ORF Clone, Rat, C-HA tag RG80184-CY
    IL10RB cDNA ORF Clone, Rat, N-HA tag RG80184-NY
    IL10RB cDNA ORF Clone, Rat, C-Myc tag RG80184-CM
    IL10RB cDNA ORF Clone, Rat, N-Myc tag RG80184-NM
    IL10RB qPCR Primer Pairs, Rat RP300176

    IL10RB cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL10RB cDNA ORF Clone in Cloning Vector, Mouse MG50846-G
    IL10RB cDNA ORF Clone, Mouse, untagged MG50846-UT
    IL10RB Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50846-ACGLN
    IL10RB cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50846-ACG
    IL10RB cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50846-ACR
    IL10RB cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50846-CF
    IL10RB cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50846-NF
    IL10RB cDNA ORF Clone, Mouse, C-His tag MG50846-CH
    IL10RB cDNA ORF Clone, Mouse, N-His tag MG50846-NH
    IL10RB cDNA ORF Clone, Mouse, C-HA tag MG50846-CY
    IL10RB cDNA ORF Clone, Mouse, N-HA tag MG50846-NY
    IL10RB cDNA ORF Clone, Mouse, C-Myc tag MG50846-CM
    IL10RB qPCR Primer Pairs, Mouse MP200817

    IL10RB cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL10RB cDNA ORF Clone in Cloning Vector, Human HG10945-M
    IL10RB cDNA ORF Clone, Human, untagged HG10945-UT
    IL10RB cDNA ORF Clone, Human, C-GFPSpark® tag HG10945-ACG
    IL10RB Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10945-ACGLN
    IL10RB cDNA ORF Clone, Human, C-OFPSpark® tag HG10945-ACR
    IL10RB cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10945-CF
    IL10RB cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10945-NF
    IL10RB cDNA ORF Clone, Human, C-His tag HG10945-CH
    IL10RB cDNA ORF Clone, Human, N-His tag HG10945-NH
    IL10RB cDNA ORF Clone, Human, C-HA tag HG10945-CY
    IL10RB cDNA ORF Clone, Human, N-HA tag HG10945-NY
    IL10RB cDNA ORF Clone, Human, C-Myc tag HG10945-CM
    IL10RB cDNA ORF Clone, Human, N-Myc tag HG10945-NM
    IL10RB qPCR Primer Pairs, Human HP100822
    info info
    添加购物车成功! 添加购物车失败!