IK cytokine/IK gene cDNA ORF Clone, Mouse, N-His tag

Cat: MG52102-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IK cytokine/IK gene Reagents
CRO Services
Product recommended

All IK cytokine/IK gene Reagents
IK cytokine/IK gene cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1674 bp
Description
Full length Clone DNA of Mouse IK cytokine with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IK cytokine/IK gene cDNA ORF Clone, Mouse, N-His tag Alternative Names
MuRED cDNA ORF Clone, Mouse
IK cytokine/IK gene Background Information
Full Name
IK cytokine, down-regulator of HLA II

IK cytokine/IK gene cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
IK cytokine/IK gene cDNA ORF Clone in Cloning Vector, Rat RG81580-G

IK cytokine/IK gene cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IK cytokine/IK gene cDNA ORF Clone in Cloning Vector, Mouse MG52102-G
IK cytokine/IK gene cDNA ORF Clone, Mouse, untagged MG52102-UT
IK cytokine/IK gene Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52102-ACGLN
IK cytokine/IK gene cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52102-ACG
IK cytokine/IK gene cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52102-ANG
IK cytokine/IK gene cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52102-ACR
IK cytokine/IK gene cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52102-ANR
IK cytokine/IK gene cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52102-CF
IK cytokine/IK gene cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52102-NF
IK cytokine/IK gene cDNA ORF Clone, Mouse, C-His tag MG52102-CH
IK cytokine/IK gene cDNA ORF Clone, Mouse, C-HA tag MG52102-CY
IK cytokine/IK gene cDNA ORF Clone, Mouse, N-HA tag MG52102-NY
IK cytokine/IK gene cDNA ORF Clone, Mouse, C-Myc tag MG52102-CM
IK cytokine/IK gene cDNA ORF Clone, Mouse, N-Myc tag MG52102-NM
IK cytokine/IK gene qPCR Primer Pairs, Mouse MP201975

IK cytokine/IK gene cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IK cytokine/IK gene cDNA ORF Clone in Cloning Vector, Human HG15486-G
IK cytokine/IK gene cDNA ORF Clone, Human, untagged HG15486-UT
IK cytokine/IK gene Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15486-ACGLN
IK cytokine/IK gene cDNA ORF Clone, Human, C-GFPSpark® tag HG15486-ACG
IK cytokine/IK gene cDNA ORF Clone, Human, N-GFPSpark® tag HG15486-ANG
IK cytokine/IK gene cDNA ORF Clone, Human, C-OFPSpark® tag HG15486-ACR
IK cytokine/IK gene cDNA ORF Clone, Human, N-OFPSpark® tag HG15486-ANR
IK cytokine/IK gene cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15486-CF
IK cytokine/IK gene cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15486-NF
IK cytokine/IK gene cDNA ORF Clone, Human, C-His tag HG15486-CH
IK cytokine/IK gene cDNA ORF Clone, Human, N-His tag HG15486-NH
IK cytokine/IK gene cDNA ORF Clone, Human, C-HA tag HG15486-CY
IK cytokine/IK gene cDNA ORF Clone, Human, N-HA tag HG15486-NY
IK cytokine/IK gene cDNA ORF Clone, Human, C-Myc tag HG15486-CM
IK cytokine/IK gene cDNA ORF Clone, Human, N-Myc tag HG15486-NM
IK cytokine/IK gene qPCR Primer Pairs, Human HP104108
info info
添加购物车成功! 添加购物车失败!