IGSF21 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51776-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IGSF21 Reagents
CRO Services
Product recommended

All IGSF21 Reagents
IGSF21 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1407 bp
Description
Full length Clone DNA of Mouse immunoglobulin superfamily, member 21 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IGSF21 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
BC055811 cDNA ORF Clone, Mouse;Gm141 cDNA ORF Clone, Mouse
IGSF21 Background Information
Full Name
immunoglobin superfamily, member 21

IGSF21 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IGSF21 cDNA ORF Clone in Cloning Vector, Mouse MG51776-G
IGSF21 cDNA ORF Clone, Mouse, untagged MG51776-UT
IGSF21 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51776-ACG
IGSF21 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51776-ACGLN
IGSF21 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51776-ACR
IGSF21 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51776-CF
IGSF21 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51776-NF
IGSF21 cDNA ORF Clone, Mouse, C-His tag MG51776-CH
IGSF21 cDNA ORF Clone, Mouse, N-His tag MG51776-NH
IGSF21 cDNA ORF Clone, Mouse, N-HA tag MG51776-NY
IGSF21 cDNA ORF Clone, Mouse, C-Myc tag MG51776-CM
IGSF21 cDNA ORF Clone, Mouse, N-Myc tag MG51776-NM
IGSF21 qPCR Primer Pairs, Mouse MP201649

IGSF21 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IGSF21 cDNA ORF Clone in Cloning Vector, Human HG13422-G
IGSF21 cDNA ORF Clone, Human, untagged HG13422-UT
IGSF21 cDNA ORF Clone, Human, C-GFPSpark® tag HG13422-ACG
IGSF21 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13422-ACGLN
IGSF21 cDNA ORF Clone, Human, C-OFPSpark® tag HG13422-ACR
IGSF21 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13422-CF
IGSF21 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13422-NF
IGSF21 cDNA ORF Clone, Human, C-His tag HG13422-CH
IGSF21 cDNA ORF Clone, Human, N-His tag HG13422-NH
IGSF21 cDNA ORF Clone, Human, C-HA tag HG13422-CY
IGSF21 cDNA ORF Clone, Human, N-HA tag HG13422-NY
IGSF21 cDNA ORF Clone, Human, C-Myc tag HG13422-CM
IGSF21 cDNA ORF Clone, Human, N-Myc tag HG13422-NM
IGSF21 qPCR Primer Pairs, Human HP102123
info info
添加购物车成功! 添加购物车失败!