IGFBP-6 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG50460-CM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IGFBP-6 Reagents
CRO Services
Product recommended

All IGFBP-6 Reagents
IGFBP-6 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
717 bp
Description
Full length Clone DNA of Mouse insulin-like growth factor binding protein 6 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IGFBP-6 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
IGFBP-6 cDNA ORF Clone, Mouse
IGFBP-6 Background Information

Insulin-like growth factor binding protein 6 (IGFBP6) is a 24-kDa protein that binds insulin-like growth factor 1 (IGF-1) and IGF-2 with high affinity and inhibits IGF action in vitro. The Insulin-like growth factor-binding protein also known as IGFBP serves as a carrier protein for Insulin-like growth factor 1. IGFBPs are clearly distinct but are sharing regions with strong homology. All members of the IGFBP family bind IGF-I and IGF-II with about equal affinity. Insulin-like growth factor (IGF) binding proteins (IGFBPs) have been shown to either inhibit or enhance the action of IGF, or act in an IGF-independent manner in the prostate. IGF-binding protein-4 (IGFBP-4) inhibits IGF-I action in vitro and is the most abundant IGFBP in the rodent arterial wall. IGFBP6 is directly downregulated by the beta-catenin/TCF complex in desmoid tumors, and imply a role for the IGF axis in the proliferation of desmoid tumors. There is mounting evidence that the structure of the IGFBP proteins plays a key role in the regulation of IGF bioavailability, by modulating its molecular size, capillary membrane permeability, target tissue specificity, cell membrane adherence and IGF affinity.

Full Name
insulin-like growth factor binding protein 6
References
  • Denys H, et al. (2004) Identification of IGFBP-6 as a significantly downregulated gene by beta-catenin in desmoid tumors. Oncogene. 23(3): 654-64.
  • Bach LA. Insulin-like growth factor binding protein-6: the "forgotten" binding protein? Horm Metab Res. 31(2-3): 226-34.
  • Bach LA. IGFBP-6 five years on; not so 'forgotten'? Growth Horm IGF Res. 15(3): 185-92.
  • IGFBP-6 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IGFBP-6 cDNA ORF Clone in Cloning Vector, Rat RG81473-G

    IGFBP-6 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IGFBP-6 cDNA ORF Clone in Cloning Vector, Mouse MG50460-M
    IGFBP-6 cDNA ORF Clone, Mouse, untagged MG50460-UT
    IGFBP-6 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50460-ACG
    IGFBP-6 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50460-ACGLN
    IGFBP-6 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50460-ACR
    IGFBP-6 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50460-CF
    IGFBP-6 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50460-NF
    IGFBP-6 cDNA ORF Clone, Mouse, C-His tag MG50460-CH
    IGFBP-6 cDNA ORF Clone, Mouse, N-His tag MG50460-NH
    IGFBP-6 cDNA ORF Clone, Mouse, C-HA tag MG50460-CY
    IGFBP-6 cDNA ORF Clone, Mouse, N-HA tag MG50460-NY
    IGFBP-6 cDNA ORF Clone, Mouse, N-Myc tag MG50460-NM
    IGFBP-6 qPCR Primer Pairs, Mouse MP200464

    IGFBP-6 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IGFBP-6 cDNA ORF Clone in Cloning Vector, Human HG13026-M
    IGFBP-6 cDNA ORF Clone, Human, untagged HG13026-UT
    IGFBP-6 cDNA ORF Clone, Human, C-GFPSpark® tag HG13026-ACG
    IGFBP-6 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13026-ACGLN
    IGFBP-6 cDNA ORF Clone, Human, C-OFPSpark® tag HG13026-ACR
    IGFBP-6 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13026-CF
    IGFBP-6 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13026-NF
    IGFBP-6 cDNA ORF Clone, Human, C-His tag HG13026-CH
    IGFBP-6 cDNA ORF Clone, Human, N-His tag HG13026-NH
    IGFBP-6 cDNA ORF Clone, Human, C-HA tag HG13026-CY
    IGFBP-6 cDNA ORF Clone, Human, N-HA tag HG13026-NY
    IGFBP-6 cDNA ORF Clone, Human, C-Myc tag HG13026-CM
    IGFBP-6 cDNA ORF Clone, Human, N-Myc tag HG13026-NM
    IGFBP-6 qPCR Primer Pairs, Human HP101683
    info info
    添加购物车成功! 添加购物车失败!